| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCCUGAUUAACCAGCUUCUCCAGGGCCAAGCUGUUGGGGGUGAGGUGC… | 2250 nt | 0.6373 |
UPK3B is a minor component of the apical plaques of mammalian urothelium that binds and dimerizes with uroplakin-1b (UPK1B; MIM 602380), one of the major conserved urothelium membrane proteins. The other major conserved integral membrane proteins of urothelial plaques are UPK1A (MIM 611557), UPK2 (MIM 611558), and UPK3A (MIM 611559) (Deng et al., 2002 [PubMed 12446744]).[supplied by OMIM, Mar 2008]
A study in mice demonstrated that single-cell RNA sequencing of epicardial-derived cells (EDCs) from a model of arrhythmogenic cardiomyopathy identified distinct cell clusters, including an epithelial cell cluster where the UPK3B was mapped as a transcript marker [Yuan et al. DOI:10.1161/CIRCULATIONAHA.120.052928].