| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUGUAGCCGGGUCAGCUGGACAGGGUCAUCCUGAGGGUGCGACUCCGC… | 1299 nt | 0.5281 |
This gene encodes the smallest known component of the ubiquinol-cytochrome c reductase complex, which forms part of the mitochondrial respiratory chain. The encoded protein may function as a binding factor for the iron-sulfur protein in this complex. [provided by RefSeq, Oct 2009]
A study in humans identified the UQCR11 as one of the top ten most central mitochondrial-associated core genes through protein-protein interaction network analysis of peripheral blood RNA-seq data from sepsis patients and healthy controls [Li et al. DOI:10.1186/s12920-024-01891-x].