| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUGACCGGCUUGGCGGUUGGAGCGGCUGUCGCCAUGUUGUCGGUAGCAU… | 3086 nt | 0.4339 |
Predicted to enable oxidoreductase activity. Involved in mitochondrial respiratory chain complex III assembly and respiratory electron transport chain. Located in mitochondrion. Part of respiratory chain complex III. Implicated in mitochondrial complex III deficiency. [provided by Alliance of Genome Resources, Jul 2025]
A study in Sarcophaga peregrina demonstrated that the UQCRFS1 shows an increasing expression tendency with intra-puparial age under both constant and fluctuating temperatures, and polynomial regression models for six differentially expressed genes, including this one, showed significant relationships (p < 0.001) between expression level and age with high coefficients of determination (R² ranging from 0.89024 to 0.98587) [Shang et al. DOI:10.3390/ani13101607].