| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAACGAGUCAACCGGAUCGGUGACUGUGGAGGGCGAGCUGAGCCCUGGC… | 1573 nt | 0.4723 |
This gene encodes a ubiquinone-binding protein of low molecular mass. This protein is a small core-associated protein and a subunit of ubiquinol-cytochrome c reductase complex III, which is part of the mitochondrial respiratory chain. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the UQCRQ gene, encoding a subunit of mitochondrial complex III, was downregulated as part of the inhibited respiratory electron transport pathway in the prefrontal cortex, hippocampus, kidneys, and heart of post-mortem sepsis patients compared to uninfected controls [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938].