| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGACAGCUGACCAUGGAAGCGAAUGGGUUGGGACCUCAGGGUUUUCCGG… | 1193 nt | 0.5549 |
This gene encodes an enzyme in the heme biosynthetic pathway. This enzyme is responsible for catalyzing the conversion of uroporphyrinogen to coproporphyrinogen through the removal of four carboxymethyl side chains. Mutations and deficiency in this enzyme are known to cause familial porphyria cutanea tarda and hepatoerythropoetic porphyria.[provided by RefSeq, Aug 2010]
A study in human patients identified the UROD as a commonly used clinical biomarker for sepsis with rapid and sensitive diagnostic performance for bacterial infection [Leng et al. DOI:10.1186/s12865-025-00702-x].