| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUGGAAGAAGAUGGCGGAAGGCGGAGCGGCGGAUCUGGACACCCAGCG… | 14884 nt | 0.3634 |
This gene encodes a member of the ubiquitin specific protease (USP) family of deubiquitinating enzymes. USP enzymes play critical roles in ubiquitin-dependent processes through polyubiquitin chain disassembly and hydrolysis of ubiquitin-substrate bonds. The encoded protein associates with the COP9 signalosome, and also plays a role in transforming growth factor beta signalling through deubiquitination of receptor-activated SMAD transcription factors. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 2. [provided by RefSeq, Nov 2011]
No relevant information is available at the moment.