Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCCCGACGUGGAACUCAGCAGCGGAGGCUGGACGCUUGCAUGGCGCU… | 1858 nt | 0.4978 |
Summary
The protein encoded by this gene belongs to the ubiquitin-specific proteases (UBP) family of enzymes that cleave ubiquitin from ubiquitinated protein substrates. It is highly expressed in liver and thymus, and is localized to the nucleus. This protein efficiently cleaves only ISG15 (a ubiquitin-like protein) fusions, and deletion of this gene in mice results in a massive increase of ISG15 conjugates in tissues, indicating that this protein is a major ISG15-specific protease. Mice lacking this gene are also hypersensitive to interferon, suggesting a function of this protein in downregulating interferon responses, independent of its isopeptidase activity towards ISG15. [provided by RefSeq, Sep 2011]
Forensic Context
A study in mice demonstrated that the USP18 transcript increased in abundance within 1 hour postmortem [Pozhitkov et al. DOI:10.1098/rsob.160267]. In human peripheral blood, the USP18 was identified as a differentially expressed gene elevated in middle-aged individuals and linked to type I interferon signaling, serving as a candidate feature in an age prediction model [Liao et al. DOI:10.1016/J.Fsigen.2025.103373].