| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAGAAGCCUGAACCGGGACAAAACACGCCGAGACCUACAGACACAAAG… | 4496 nt | 0.4758 |
Uronyl 2-sulfotransferase transfers sulfate to the 2-position of uronyl residues, such as iduronyl residues in dermatan sulfate and glucuronyl residues in chondroitin sulfate (Kobayashi et al., 1999 [PubMed 10187838]).[supplied by OMIM, Mar 2008]
A study in mice selectively bred for high or low methamphetamine intake identified the UST as a differentially expressed gene overexpressed in the high-drinking line in the ventral midbrain, with this finding overlapping with a prior microarray study [Hitzemann et al. DOI:10.3390/brainsci9070155].