| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAUAUCCUCUUUGGCUACUGAGCGCACUCCUCUCCCGCAGCCGGCAGCG… | 5313 nt | 0.4143 | |
| GUUUUUCCUCGGAGCAGGGAAGCGGGCAGCAGCAGCCGGCCGCGGGCUU… | 12918 nt | 0.4332 |
This gene shares both structural and functional similarities with the dystrophin gene. It contains an actin-binding N-terminus, a triple coiled-coil repeat central region, and a C-terminus that consists of protein-protein interaction motifs which interact with dystroglycan protein components. The protein encoded by this gene is located at the neuromuscular synapse and myotendinous junctions, where it participates in post-synaptic membrane maintenance and acetylcholine receptor clustering. Mouse studies suggest that this gene may serve as a functional substitute for the dystrophin gene and therefore, may serve as a potential therapeutic alternative to muscular dystrophy which is caused by mutations in the dystrophin gene. Alternative splicing of the utrophin gene has been described; however, the full-length nature of these variants has not yet been determined. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the UTRN (Dnm1l) mRNA was validated as a mis-spliced target in the hearts of cardiomyocyte-specific Mbnl1/Mbnl2 double knockout animals, which recapitulated myotonic dystrophy cardiac pathology and sudden death [Lee et al. DOI:10.1093/hmg/ddac108].