| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCCGGGAGCGCAGCUGGGCCGCGGCGCUCCGACCUCCGCUUUCCCAC… | 1542 nt | 0.4189 |
This gene is encodes a mitochondrial protein that contains a BH3 domain and acts as a pro-apoptotic factor. The encoded protein interacts with anti-apoptotic proteins, including the E1B 19 kDa protein and Bcl2. This gene is silenced in tumors by DNA methylation. [provided by RefSeq, Dec 2014]
A study in differentiated human SH-SY5Y neuronal cells demonstrated that the BNIP3 was consistently differentially regulated across exposures to six different per- and polyfluorinated alkyl substances (PFAS), linking it to hypoxia-related pathways as a potential biomarker for neuronal PFAS toxicity [Running et al. DOI:10.1021/acschemneuro.4c00652]. A study in differentiated human SH-SY5Y neuronal cells demonstrated that exposure to six PFAS compounds consistently induced differential regulation of the BNIP3, which is linked to hypoxia, across all treatments [Running et al. DOI:10.1021/Acschemneuro.4C00652].