Basic Information

Symbol
BNIP3
RNA class
mRNA
Alias
BCL2 Interacting Protein 3 HABON Nip3 BCL2/Adenovirus E1B 19 KDa Protein-Interacting Protein 3 Hypoxia-Activated BNIP3 Overlapping Non-Coding RNA BCL2/Adenovirus E1B 19kDa Interacting Protein 3 Nineteen KD Interacting Protein-3 BCL2/Adenovirus E1B Interacting Protein 3 NIP3
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_004052.4
Sequence length
1542.0 nt
GC content
0.4189

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-416.70 kcal/mol
Thermodynamic ensemble
Free energy: -447.13 kcal/mol
Frequency: 0.0000
Diversity: 371.24
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((.(.(((((.((.((((((((((((((..(.((((((..(((((((((((((..((((............)))).))).)))).(((((.((((.((((.((((....)))).).))).)).)).))))).((((((((((((((.......))))))....)))))))).....(((......)))....))))))))))))))))).(((((.(((((((((((((...))))))))).............(((((......))))))))).)))))..(((.(((((...)))))))).)))))...))))).))))))).).)))......((((((...((((...))))..(((((........(((..((((((..................((((((((.(((((((((((((((.....((((...(((((((((((((..(((((...((((....((((((((((.....)))))).......)))).)))).)))))..))))(((((((.....(((...(((((((((((((((((((.....(((((.((.((.((..(((((...(((.....((((...))))..)))...)))))..)))))).))))))))))..))))).(((......)))((.(((.((((((((((.(.(((...........)))).)))))))))).))).))(((.((((((..(((((.((((((((.....)))(((((........)))))))))).)))))))))))))).))))))))).))).....)))))))....((((((.....((((((((....((((((.................))))))....((((((((((((........))).))))))))).....((.((((........)))))).(((((((((((....)))))))))))..((((((.......))))))(((((.(((((((((((..((((.((((..(((((((((.............((((((..........((((...(((((((.....)))))))...))))..........)))))).(((((.((......)).)))))((((((........))).)))..))))))))).)))).))))..))).)))))))))))))...))))))))....(((.....)))..((((((..((((.........))))..)))))).))))))..))))))...)))...)))).((.(((((.....)))))))....)))))))((....)).......(((........)))((((((((((.......))).))))))).((((((....))))))......))))))))))))))))....((((.(......)))))........))))))..)))........)))))...............((((......))))......)))))).............(((..(((.(((...........))).)))..)))......
Thermodynamic Ensemble Prediction
.(((.(.(((((.((.((((((((((((((..(.((((((..{(((({,.{{{{{..((({{{{..,.(((.(((.(((((.(((..(((((.((((.(((,.((((....)))).,.))).)).)).))))))))))))).))).)))|{.{{{|||,,.))))}}}}|||,.....|||.}}}}})).....)))))}))))))})))).(((((.(((,(((((((({...))))))))).............(((((......))))),))).))))).,(((.(((((...)))))))).)))))...))))).))))))).).)))......((((,,...{(((,..||||..(((((........(((..((((((.......,,,...,},..((((((((.((((((((.{(,(((..,{{{(({...{{|,||{((((((..(((((...((((....((((((((((.....)))))).......)))).)))).)))))..))))|{(((((..,..(((...(((((((((((((((((((.....(((((.((.(,{((..(((((.,.,..,,.,.((((...})))..})..,.)))))..)))))).)))))))))),.})))),(((......)))((.(((.((((((((((.(.(((...........)))).)))))))))).))).)}(({,((((((..(((((.(((((({{.....}}}(((((........)))))))))).)))))))))))))).))))))))).)))..,..)))))}|,{{,((((((...{,((({(({{...||,||||,..,|,..,}}}}}||,}},.......((((((((((((........)))}))))))))).{{({((((((({{...,{{{{{....(((((((((((....)))))))))))..)}}}||(((((....)))))}}{{,{{{{,.,,|||,.|||,.|}}}}.|}}}}})}{{{{{{..|......,,},,|||}}|{{{,({{{{,{(((((((.....)))))))...,||||.....,,,,{{{....,,||||({....,,}),|||||,,||.,.,,...,,.|||||}...,},,}})),},}},)))}||.,||||||||||..,}}}}}))))))}},,,.|||,....,||..((((((,,({{{.,|,..,},))}),.}}}}}}.}}}}}}..}}}}}},,,|}|...,,,},||,|((((.....))))},,....}}})}}|((....))}......(((........)))((((((((((.,....}))),})))))).((((((....)))))).}}}..)))))))))))))))).,,,((({.,.....,)))))........))))))..)))........)))))..|||,.........((({......))))..,}}})))}}}.............(((..(((.,{,...........))}.)))..)))..,,,.

Transcripts

ID Sequence Length GC content
AGUCCGGGAGCGCAGCUGGGCCGCGGCGCUCCGACCUCCGCUUUCCCAC… 1542 nt 0.4189
Summary

This gene is encodes a mitochondrial protein that contains a BH3 domain and acts as a pro-apoptotic factor. The encoded protein interacts with anti-apoptotic proteins, including the E1B 19 kDa protein and Bcl2. This gene is silenced in tumors by DNA methylation. [provided by RefSeq, Dec 2014]

Forensic Context

A study in differentiated human SH-SY5Y neuronal cells demonstrated that the BNIP3 was consistently differentially regulated across exposures to six different per- and polyfluorinated alkyl substances (PFAS), linking it to hypoxia-related pathways as a potential biomarker for neuronal PFAS toxicity [Running et al. DOI:10.1021/acschemneuro.4c00652]. A study in differentiated human SH-SY5Y neuronal cells demonstrated that exposure to six PFAS compounds consistently induced differential regulation of the BNIP3, which is linked to hypoxia, across all treatments [Running et al. DOI:10.1021/Acschemneuro.4C00652].