Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| UGAGUCGGCCGCCCGCCACCCUCACCGCGCUUCCCUGCGCCGGCCGCCG… | 2508 nt | 0.5574 | |
| AGUCGGAGCCAGCGCGAGCCGCCGCCGCCAUCACUGCCGCUGCCAAGUC… | 2126 nt | 0.5315 |
Summary
The protein encoded by this gene is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family. Synaptobrevins/VAMPs, syntaxins, and the 25-kD synaptosomal-associated protein SNAP25 are the main components of a protein complex involved in the docking and/or fusion of synaptic vesicles with the presynaptic membrane. This gene is thought to participate in neurotransmitter release at a step between docking and fusion. The protein forms a stable complex with syntaxin, synaptosomal-associated protein, 25 kD, and synaptotagmin. It also forms a distinct complex with synaptophysin. It is a likely candidate gene for familial infantile myasthenia (FIMG) because of its map location and because it encodes a synaptic vesicle protein of the type that has been implicated in the pathogenesis of FIMG. [provided by RefSeq, Jul 2008]
Forensic Context
A study in porcine skin demonstrated that the VAMP2 transcript was significantly increased in the 8 min–24 h post-exposure group following cutaneous bromine injury, as identified via microarray analysis [Price et al. DOI:10.1016/j.toxlet.2008.08.007]. A study in rats demonstrated that the VAMP2 was downregulated in spinal cord tissue samples from the injury epicenter, as well as 1 cm rostral and 1 cm caudal to the epicenter, following contusive spinal cord injury [Aimone et al. DOI:10.1016/j.expneurol.2004.05.042].