| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUCCCACCCAUCUCCCUGGCCUCCGGUCCCAACUUCGCUUCUCUGCUGA… | 2178 nt | 0.4229 |
Synaptobrevins/VAMPs, syntaxins, and the 25-kD synaptosomal-associated protein are the main components of a protein complex involved in the docking and/or fusion of synaptic vesicles with the presynaptic membrane. This gene is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family. Because of its high homology to other known VAMPs, its broad tissue distribution, and its subcellular localization, the protein encoded by this gene was shown to be the human equivalent of the rodent cellubrevin. In platelets the protein resides on a compartment that is not mobilized to the plasma membrane on calcium or thrombin stimulation. [provided by RefSeq, Jul 2008]
A study in humans and mice demonstrated that VAMP3 was upregulated in whole blood cells and peripheral blood mononuclear cells of patients who developed heart failure after acute myocardial infarction [Chen et al. DOI:10.3389/fimmu.2022.878876].