| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUGCGGCCGCUCCGCAGGCAGAGAAGCCGGGAGCGGGCGAGGCGGCGG… | 660 nt | 0.5909 |
Synaptobrevins/VAMPs, syntaxins, and the 25-kD synaptosomal-associated protein are the main components of a protein complex involved in the docking and/or fusion of vesicles and cell membranes. The VAMP5 gene is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family and the SNARE superfamily. This VAMP family member may participate in vesicle trafficking events that are associated with myogenesis. [provided by RefSeq, Jul 2008]
A study in human postmortem-derived iPSC neurons demonstrated that morphine treatment induced concordant upregulation of the VAMP5 in both the cellular model and ex-vivo brain tissue from individuals with opioid use disorder, validating its dysregulation as part of the opioid exposure response [Mendez et al. DOI:10.3389/Fpsyt.2023.1070556].