| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCGGGCCGUAGUCGAGCCUGGUGGGCGGCUGGCUGGCAGGGGACGUGGU… | 6449 nt | 0.6006 |
Enables actin binding activity and metallocarboxypeptidase activity. Involved in negative regulation of angiogenesis; negative regulation of blood vessel endothelial cell migration; and proteolysis. Acts upstream of or within several processes, including negative regulation of endothelial cell proliferation; negative regulation of lymphangiogenesis; and regulation of cellular senescence. Located in apical part of cell; endoplasmic reticulum; and extracellular space. Implicated in liver cirrhosis and portal hypertension. Biomarker of liver cirrhosis. [provided by Alliance of Genome Resources, Jul 2025]
A study in human postmortem prefrontal cortex demonstrated that the VASH1 was identified as a high-confidence gene in common between mice and humans within the top 10% of genes related to lifetime alcohol consumption [Farris et al. DOI:10.1038/Mp.2014.159].