| ID | Sequence | Length | GC content |
|---|---|---|---|
| GACUCCGGAGCCCGAGCCCGGGGCGGGUGGACGCGGACUCGAACGCAGU… | 2816 nt | 0.6619 |
Enables transforming growth factor beta binding activity. Involved in negative regulation of epithelial to mesenchymal transition and negative regulation of transforming growth factor beta receptor signaling pathway. Located in cell surface and extracellular exosome. [provided by Alliance of Genome Resources, Jul 2025]
A study in human blood plasma from 103 individuals demonstrated that the VASN was significantly upregulated with age [Salignon et al. DOI:10.18632/aging.204787]. In a separate forensic proteomic workflow for body fluid classification, the VASN was identified as a discriminatory protein for urine, exhibiting a Gini impurity score of 0, meaning it was present in most pure urine samples and mixtures containing urine but absent in mixtures without it, thereby enabling accurate body fluid identification in complex forensic samples [Shehata et al. DOI:10.1016/j.fsigen.2025.103343].