Basic Information

Symbol
VASP
RNA class
mRNA
Alias
Vasodilator Stimulated Phosphoprotein Vasodilator-Stimulated Phosphoprotein
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_003370.4
Sequence length
2242.0 nt
GC content
0.5959

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-970.50 kcal/mol
Thermodynamic ensemble
Free energy: -1005.41 kcal/mol
Frequency: 0.0000
Diversity: 722.26
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((.((.......))))))).((((....)))).((((((.((.(((((.(.(((((((((((((((((((.((((((.((......(((..((((((...((((.(..(((.(((..((((.(((((((((....(((((...((((.....))))...)))))...)))))))))....((((((.(((((.((.(..(((((.((..(((((......(((......)))...))))))).)))))..).))........(((((...)))))((((((.((((((..((((.((...)).))))))))))..).))))).(((.(((((((((..((((((((((.((...(((((((.((((((((..(((((.....(((.....)))........((((.((.....(((((((((..........).))))))))..)).))))...))))).)))))))).)))))))...)))))))))))).)))))))))))).....)))))..))))))..))))....))).)))..).))))...)))))))))......)).)))))).)))).)))))))))...))))))).)))))..(((....)))(.((((((...((..(((((((((...(((....((((((.((((((((...(((((........)))))..(((((((.((.((.(((((((.......(((.((.(((((......))).)).......)))))((((((((......))))))))..))))))))))).)))))))....((((((((.((..((((....((((((((..((...((((((((.(((((...((((((...))))))(((.(((((..((...((((.(((((((((.......)))...)))))))))))))))))...))).))))).))))))))(((((.((((........)))).))))).(((((((..((.......))....))))))))).)))))))).(((((((((((.....))))))....)))))...)))).....)).)))))))).((((((((((((..........(((((((((......))...)))).)))..((((((.......)))))).(((..........))).((((((((((((((...((((((((((((((((((((((((......((((..(((((((((.(((((.......((((.(((((..((.((..(((((((...(((.(((((((..........(((.(...(((((((((....))).))).......(((((((..((((((((((((((.(((((...((..((.((.(.............).)).)).))...)))))..))))))))))..(((((((((.(((((((((....))))))....)))..))))))))).....(((......)))))))))))))))))...).)))..........))))))).))))))))))..)))).((((((...)))))).......)))))..((((((....)))))).(((((((((......)).)))))))....)))))))))...(((.((((....))))))).)))))))))...))))((((((((.(((.((((((..((((......))))....)))))))))((..((.....))..))..))))))))(((.((((((((.....)))))))).))))))))))))))...(.(((((.((((...........((((((((.....))))))))............)))).))))).).(((((((((......)))))))))..............(((.(((((.(.........).))))).)))))))))((((((....)))))).........((((.((((((((((((((........))))))))))))))...)))).)))))))......))))))))))))))..))))))))))))(((((((((.((((................)))).)))).))))).....)))).)))).))))))...)))...((((((((..((((((............))))))..))))))))(((((((((...))))))))))))))))))..))...)))))).)....)).))))))(((((.....))))).............
Thermodynamic Ensemble Prediction
,{{{{.((,......,,}|||}.((((....}))).(((((({({{(((((,(,((((,||||||||||||{{,((({{{||||....((((.((((.....}))))))},|}|||,(((((.(.(((((((((....(((((...((((.....))))...)))))...))))))))).},)}}}}(({{((((,(({{.{((((({(({{((((({{{.{{(,{...{{{|||{.{|||||||{|||||{{|{||{{{...((((({(,,,,||}}||{|({.((((((..((((.((...)).))))))))))..},|)}||,,(((((,.,{{{{..((((((((({,((...(((((((.((((((((..(((((.....(((.....))){{{,,...{(((.((.....(((((((((.,......,.).))))))))..)).})))}}.))))).)))))))).)))))))...)))))))))))).((((((((..{{...,,..))}}))))).....,{||.|||||||{||...,,,{{{{||{|||{{{{{{{{.||,||||,|,||||.||,,|,||||,.,}))))}})))}},,{{((,{{({{...{,||}|||||..(({(({({,..,}})))|||{|||||.||||({{{{{(((((........))))){{((,..,}}))}||}||{(({(,......{||.||.{|{{({....}))).)}.....{{|||}}((((((((......))))))))..})))))}||||}))))))),...(((((((({(({((.(({({{(((,((((.{(,...{{{|,(((.{{{((...{(((((...)))))),||.(({{{...}}..||}|.||||||}}}....{{{|||{{.,|||,......)),,)),..))).)))))}))))))))||,|}}||||}}}}}}}}))))}),)))}}|),))}|{(({{..{{((|.((((,{{.|.(((((.(((((((((((((((((.....))))))....))))).|,||,|{..((((.((|,|({|.(((.,(((((,,.{(..{(((.(((((((((......))...)))).)))..{(((((.,.....)))))}.,.....{{{.((...,.||,|||(((,,,|||(((.((((({{(.((((.....)))).))}).))).)))((((((((.{.{{.{{.((({...}))).))..}}.})))))))}||}}..}}}}||||||.}}}.}}}}}|}.}}.}}||}{{{{{|....})).))}.......(((((({.,((((((((((((((.(((((...,{..((.((.(.............}.)}.)).))...)))))}.)))))))))){,(((((((((.(((((((((....)))))}...,)))..))))))))),,...(((......)))))))))))))))))}}})}))).,)}})))..)))))..})))))))}}.,..}}},((((((...))))))....,{,||{(((.((((((....))))))}|||||||||,,....))}),,,)))}}.}))))))))|,.,(((.(((({{{,|||,},,...,,,,,,,...)),}}}})})}...))}}||||},,))))}..}))))),.))})))).,.,{,,,.....{{{|...,,..))))|||((((.((((((((.....)))))))).)))).,.,,,{{{{{,,.((.....)).|,.}}}}}.,}}||((((({....,))))||||,,....,,,}},)))}})))))),.(((((((((......)))))))))..,,,.....,,,,(((.{((((.{,,.......}.))))}.)))..((({{(((((....))))))))}.....{((((((((((.(((((...(((.((((((.((....)))))))),))).)))))))))))))))))))))))),,}.,|||,,,,,|)})|{{,(((((.((((...,,....},.....)))).))))},}}},,,....)))).)))))))))})}).|||{{{{{({,,,..,,...|||||,...{((.((((((.{,,,((.(,(((((((({...}))))))))))}.))))),})))},.))))),},,,,})})))))}(((((.....))))),,},..,,,,...

Transcripts

ID Sequence Length GC content
ACAGUAGUAAGAGUAACACUGUAGCCGCCACCGGCAAGGGGUGCGCGCU… 2242 nt 0.5959
Summary

Vasodilator-stimulated phosphoprotein (VASP) is a member of the Ena-VASP protein family. Ena-VASP family members contain an EHV1 N-terminal domain that binds proteins containing E/DFPPPPXD/E motifs and targets Ena-VASP proteins to focal adhesions. In the mid-region of the protein, family members have a proline-rich domain that binds SH3 and WW domain-containing proteins. Their C-terminal EVH2 domain mediates tetramerization and binds both G and F actin. VASP is associated with filamentous actin formation and likely plays a widespread role in cell adhesion and motility. VASP may also be involved in the intracellular signaling pathways that regulate integrin-extracellular matrix interactions. VASP is regulated by the cyclic nucleotide-dependent kinases PKA and PKG. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans identified VASP as a novel diagnostic biomarker for burn injury, showing significant upregulation in burn tissues (p < 0.0001) with an area under the curve (AUC) > 0.9, indicating high diagnostic efficacy [Zhou et al. DOI:10.3389/fgene.2022.829841].