| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCCGUCCCCGCCGCCGCUGCCCGCCGCCACCGGCCGCCCGCCCGCCCGG… | 1704 nt | 0.6174 | |
| GCCGUCCCCGCCGCCGCUGCCCGCCGCCACCGGCCGCCCGCCCGCCCGG… | 1805 nt | 0.6222 |
This gene encodes a member of the PDGF (platelet-derived growth factor)/VEGF (vascular endothelial growth factor) family. The VEGF family members regulate the formation of blood vessels and are involved in endothelial cell physiology. This member is a ligand for VEGFR-1 (vascular endothelial growth factor receptor 1) and NRP-1 (neuropilin-1). Studies in mice showed that this gene was co-expressed with nuclear-encoded mitochondrial genes and the encoded protein specifically controlled endothelial uptake of fatty acids. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Sep 2011]
A study in rats demonstrated that VEGFB mRNA expression was transiently down-regulated at 2 hours after a 5 psi blast exposure but was elevated at higher blast overpressures, indicating its role as an angiostasis/angiogenesis inhibition marker in the vascular wound healing response to mild traumatic brain injury [Balaban et al. DOI:10.1016/j.jneumeth.2016.02.001]. In a separate cross-species atlas of the corpus cavernosum, VEGFB was identified as a dominant angiogenesis signaling ligand in the rat CC microenvironment [Yin et al. DOI:10.1016/j.celrep.2024.114760]. In a separate rat model of cortical cold injury, the VEGFB protein was constitutively expressed in endothelial cells of all cerebral vessels in controls, with decreased endothelial expression post-injury and recovery by day 6, and it was not expressed in the endothelium of vessels leaking protein [Nag et al. DOI:10.3390/ijms20071594].