| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUGCCCUGCCCCUGCGCCCGCCGCCGCCGCCGCCGCCGCUCAGCCCGGC… | 2259 nt | 0.5436 |
The protein encoded by this gene is a member of the platelet-derived growth factor/vascular endothelial growth factor (PDGF/VEGF) family. The encoded protein promotes angiogenesis and endothelial cell growth, and can also affect the permeability of blood vessels. The proprotein is further cleaved into a fully processed form that can bind and activate VEGFR-2 and VEGFR-3 receptors. [provided by RefSeq, Apr 2014] CIViC Summary for VEGFC Gene
No relevant information is available at the moment.