Basic Information

Symbol
VEGFD
RNA class
mRNA
Alias
Vascular Endothelial Growth Factor D VEGF-D FIGF C-Fos Induced Growth Factor (Vascular Endothelial Growth Factor D) C-Fos-Induced Growth Factor
Location (GRCh38)
Forensic tag(s)
Wound age identification Mechanical injury analysis

MANE select

Transcript ID
NM_004469.5
Sequence length
2069.0 nt
GC content
0.4345

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-580.20 kcal/mol
Thermodynamic ensemble
Free energy: -621.52 kcal/mol
Frequency: 0.0000
Diversity: 469.69
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....((((((((((((.....((((.((((((((....((((((((((..(((((.((..(.(..(((..((((((.((((((((....(((((.....)))))..)))))..))).)).)))).))).).)..)).)))))))))))))))))))))))))))..((((((.....(((((....))))))))))).))))))).))))).....(((((((((.....(((((......(((......)))......))))).......((((...((((.........)))))))).(((((.((((...)))))))))....))))))))).........(((((((((.((((..(((((((.(((((((....(((..((((((((.................))))))))....(((((..(.........)..))))).)))..)))))))..))))))).)))).))))((((((((((((..(((((((..(((((...))))).((((((.((((((.((((((.....)).)))))).(((((((((....(((((((((...))))..((((((.....))))))((((((((...((((((((((......))))))))))..........((((((((.((((.((((((.((.(((((((((....)))))...)))).)).).)))).).)))).)))....)))))(((.(((((...((..(((((((((((.((.........)).))))))))..)))....))...))))).)))))))))))........((((.((((.((((((((.(((((((....(((((..(((((.(((..((((....))))...))).)))))..(((((((.((((((((((........((((((((((((((((....((((.....((((...((((((......)))).)).....)))).(((((((...((((........)))).)))))))))))....))))))))...))))).))))).))))))))..))).))))..)))))...........((((......))))((((.((((((((.(((((((..............(((((((((.........))))))))).((((.((....)).))))..(((((.(((...))).))))).)))))))..))....)))..))).))))..))))))).))...))))))(((((.(((((((((....(((...)))...))))....))))).))))).............)))))))).......(((((((((((((((((((.......((((..((.(((((((.(((((((((((..((.(((((..((((((.(((((((((.(((((((.......(((.((((........)))).)))(((((((.(((((((.((((....))))((((.....(((((......(((((((....))).....)))).......))))).....)))).................((((........))))))))))).))))))).((((((((((((((..........((((((....((((......))))....)))))))))))))...)))..))))..((((((...(((((....((...))))))).....)))))))))))))))))))))).))..))))..((((((((((((((((.(((((((.........))))..........))).))))))))))))))))..))))).)).))))))..)).)))...))))))).))....))))...)))))))))))..........))))))))..)))))....)))))..)))).((....))(((((((((((((........)).))))))..)))))...(((((((..........)))))))))))))))))...........(((((...)))))......(((....)))..(((((......))))))))))))..)))))))))))))))))
Thermodynamic Ensemble Prediction
.....((((((((((((.....((((.((((((({...,((((((((((..(((((.((..,{(,.(((..((((((.((((((((....(((((.....)))))..))))),.,)).)).)))).))).)})..)).)))))))))))))))))))))))))))..((((({....,(((((....))))))))))}.))))))).))))).,...{((((((((.....(((((......(((......)))......)))))........,{{..,{({(.......|||,,.,,))}((({,{((({...}))))))))....))))))))}.,,......{((({{(((.((((..((((((({(((((({....{((..((((((((.................))))))))....{{(((,,(.,,,,....,..)}))),})),,))))))).}))))))).)))).))),{(((((((((((..(((((((..(((((...})))).((((((.((((((.(((({{.....}}.)))))).(((((((((....(((((((({...})))..((((((.....))))))((((((((...((((((((((......)))))))))).{{,...})}((((((((.((((.((((((,({,(((((((((....))))),.,)})).)).}.)))).).)))).)))....)))))(((.(((((,,.({..(({((((((((.{(.........}}.))))))))..}))..,.)),..})))).)))))))))))........((((.((((,((((((((.(((((((,(((((((....{{{{}|||},|,,,....}}}},|,}}}.}}|}},.(((((((.(((((((((,.......,((((((((((((((((....,,(({,...({{,,{,(({(({......})))}))},,..))))((((((((...((((........)))).)))))))).,}....))))))))}..,)))).))))),})))))))..))),})))..,,,,,.....{{{{..((((......)))).||}},||.|,,,{((({{(((((..({.......,((((.....)))}}}..)))))))))}.,,...,,,..,|.||||||(((((.(({...))).))))},||}}}}|,,||....}})}.}})})))}..))))))).))...)))))){|{{{.{{{{{{{{{.,{{((,|{{,||,,{|||,....,,))),}}}})}.}},.}}}},..))}))))}.......(((((((((((((((((((.......((((,,((.(((((((.((({,((((({..((.(((((.,((((((.(((((((((.(((((((..,{{{.(({.((({........)))).}}},||||{,.(((((((.(((({{{,,|||((((.,...(((((......((((({,..{,}},.,..,)))).......))))),....}))).................((((........))))})))))),))))))).,||}|||(((((((..........((((((....{(({......))))....)))))))))))))...}}|...,.,..(((({{{{.,,,(({{,.{{....})))))}...})))))))))))))))))))))).))..)))).,((((((((((((((((.(((((((.........))))},,.,,....,}}.})))))))))))))))..})))).)).))))))..}}.)))..,))))))).))....))))..,)))))))))))..........))))))))..)))))....)))))..)))).,.....||((((((((((({{........)}.))))),.,))))),..{((((((..........)))))))))))))))))....,......{{{{,.,,|||}}......{{{.,..))),.{{{{{,....,}}}},)))))))..))))))))))))}))),

Transcripts

ID Sequence Length GC content
AAGACACAUGCUUCUGCAAGCUUCCAUGAAGGUUGUGCAAAAAAGUUUC… 2069 nt 0.4345
Summary

The protein encoded by this gene is a member of the platelet-derived growth factor/vascular endothelial growth factor (PDGF/VEGF) family and is active in angiogenesis, lymphangiogenesis, and endothelial cell growth. This secreted protein undergoes a complex proteolytic maturation, generating multiple processed forms which bind and activate VEGFR-2 and VEGFR-3 receptors. This protein is structurally and functionally similar to vascular endothelial growth factor C. Read-through transcription has been observed between this locus and the upstream PIR (GeneID 8544) locus. [provided by RefSeq, Feb 2011]

Forensic Context

A study in rats demonstrated that the VEGFD mRNA was significantly upregulated at a cortical cold-injury site, peaking at a ~14-fold increase on day 4 post-injury [Nag et al. DOI:10.3390/ijms20071594]. A study in rats demonstrated that the VEGFD (FIGF) mRNA was significantly downregulated in fetal cardiac fibroblasts compared to neonatal cardiac fibroblasts, indicating its role in developmental gene expression shifts [Perreault et al. DOI:10.1152/physiolgenomics.00074.2021]. In a separate forensic pathology study investigating rat skin incision wounds, the VEGFD (FIGF/VEGF-D) mRNA was analyzed as a lymphangiogenic factor, though no statistically significant change in its expression was reported during the early wound healing stages [Kameyama et al. DOI:10.1016/J.Legalmed.2015.02.007].