Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCGUGCUGAAGCCGGAGCGAGCUAGCCGCCCGGAGCCGCGCCGACCCA… | 2551 nt | 0.7048 |
Summary
This gene is specifically expressed in a subpopulation of neuroendocrine cells, and is upregulated by nerve growth factor. The structural organization of this gene is similar to that of the rat gene, and both the translated and the untranslated regions show a high degree of sequence similarity to the rat gene. The encoded secretory protein also shares similarities with the secretogranin/chromogranin family, however, its exact function is not known. [provided by RefSeq, Jul 2008]
Forensic Context
A study in rats demonstrated that the VGF was significantly up-regulated in the L4 and L5 dorsal root ganglia (DRG) with a fold change of 2.7 following ultraviolet-B-induced inflammation, and it is implicated in modulating pain processing [Dawes et al. DOI:10.1371/journal.pone.0093338].