Basic Information

Symbol
VHL
RNA class
mRNA
Alias
Von Hippel-Lindau Tumor Suppressor VHL1 Von Hippel-Lindau Tumor Suppressor, E3 Ubiquitin Protein Ligase Von Hippel-Lindau Disease Tumor Suppressor Protein G7 PVHL Von Hippel-Lindau Syndrome Elongin Binding Protein HRCA1 RCA1
Location (GRCh38)
Forensic tag(s)
Wound age identification

MANE select

Transcript ID
NM_000551.4
Sequence length
4414.0 nt
GC content
0.4631

Transcripts

ID Sequence Length GC content
GCAGCUCCGCCCCGCGUCCGACCCGCGGAUCCCGCGGCGUCCGGCCCGG… 4414 nt 0.4631
GCAGCUCCGCCCCGCGUCCGACCCGCGGAUCCCGCGGCGUCCGGCCCGG… 4550 nt 0.4690
GCAGCUCCGCCCCGCGUCCGACCCGCGGAUCCCGCGGCGUCCGGCCCGG… 4291 nt 0.4631
Summary

This gene encodes a component of a ubiquitination complex. The encoded protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. In addition to oxygen-related gene expression, this protein plays a role in many other cellular processes including cilia formation, cytokine signaling, regulation of senescence, and formation of the extracellular matrix. Variants of this gene are associated with von Hippel-Lindau syndrome, pheochromocytoma, erythrocytosis, renal cell carcinoma, and cerebellar hemangioblastoma. [provided by RefSeq, Jun 2022] CIViC Summary for VHL Gene Von Hippel-Lindau (VHL) disease is characterized by heterozygous germline mutation in VHL gene on chromosome 3p. Patients are predisposed to developing hemangioblastomas of the brain, spinal cord, and retina; renal cysts and clear cell renal cell carcinoma; pheochromocytoma, pancreatic cysts and neuroendocrine tumors; endolymphatic sac tumors; and epididymal and broad ligament cysts. Cerebellar hemangioblastomas may be associated with headache, vomiting, gait disturbances, or ataxia. Spinal hemangioblastomas and related syrinx usually present with pain. Sensory and motor loss may develop with cord compression. Retinal hemangioblastomas may be the initial manifestation of VHL disease and can cause vision loss. Renal cell carcinoma occurs in about 70% of individuals with VHL and is the leading cause of mortality. Pheochromocytomas can be asymptomatic but may cause sustained or episodic hypertension. Pancreatic lesions often remain asymptomatic and rarely cause endocrine or exocrine insufficiency. Endolymphatic sac tumors can cause hearing loss of varying severity, which can be a presenting symptom. Cystadenomas of the epididymis are relatively common. They rarely cause problems, unless bilateral, in which case they may result in infertility. The VHL gene product encodes pVHL, which binds to elongin C, elongin B, cullin-2 and Rbx1. This complex catalyzes the polyubiquitinylation of specific proteins and targets them for degradation by proteosomes. For example, under normoxic conditions, hydroxylated hypoxia-inducble factor alpha subunits (HIFα) binds pVHL targets HIFα for degradation. Under hypoxic conditions, HIF1α is not hydroxylated, pVHL does not bind, and HIF1α subunits accumulate. HIF1α forms heterodimers with HIF1β and activates transcription of a variety of hypoxia-inducible genes (i.e., VEGF, EPO, TGFα, PDGFβ). Likewise, when pVHL is absent or mutated, HIF1α subunits accumulate, resulting in cell proliferation and the neovascularization of tumors characteristic of VHL disease. Pathogenic variants in VHL either prevent its expression (i.e., deletions, frameshifts, nonsense mutations, and splice site mutations) or lead to the expression of an abnormal protein (i.e., missense mutations). Missense mutations that destabilize packing of the alpha-helical domains, decrease the stability of the alpha-beta domain interface, interfere with binding of elongin C and HIF1α, or disrupt hydrophobic core residues result in loss of HIF regulation and are more likely to result in VHL type 1 (no predisposition to pheochromocytoma). Missense mutations that result in pVHL that is normal with respect to HIF regulation are more likely to be associated with VHL with clinical pheochromocytoma. Acquired somatic pathogenic variants in VHL may give rise to sporadic VHL-type tumors (i.e., clear cell RCC and hemangioblastoma) without other associated tumors characteristic of the hereditary disease. It should be noted that >90% of the most common form of kidney cancer (clear cell renal cell carcinoma) are associated with bi-allelic somatic mutation in the VHL gene, and is the rationale for the anti-angiogenic therapy for RCC patients.

Forensic Context

A study in mice demonstrated that pharmacological inhibition of exosome biogenesis reduced neovascularization and delayed wound closure, which was rescued by topical application of fibroblast-derived exosomes [Chen et al. DOI:10.1093/burnst/tkae071].