Basic Information

Symbol
VIM
RNA class
mRNA
Alias
Vimentin Epididymis Secretory Sperm Binding Protein
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Wound age identification

MANE select

Transcript ID
NM_003380.5
Sequence length
2154.0 nt
GC content
0.5432

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-753.40 kcal/mol
Thermodynamic ensemble
Free energy: -790.81 kcal/mol
Frequency: 0.0000
Diversity: 471.84
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((((....))).)))))((((((((((((((..(((.((((.........((.((((((.(((((((..(((..(((......(((((......)))))(((((((((((((((((((..(((((((.(((((..(((((..(((....)))..)))))..).)))).((.(((........))).))..((((...))))..(((((.((.....)).)))))..((((((.....))))))...)).))))).....)).))))))..))))))).))))..)))..))).))))(((((((..((.((((((((((((..((((((((.(((............((((..((.((((.((........)))))).))..))))(((((((((.(((...(((..((((..((((((........((((.((((((.((((.(((((((((........))))))......(((((((((..(.((((((((((..(((((((..(((((.((((....))))......((((((.((.((((((((.(((((((((.....((....)))))))).....((((.((....))))))(((((.....)))))(((((.(.((.....))..).))))).))))))))))).))(((((((((((((((((((((..........((((....))))....)))))))))............((((........))))...))))))))))))............................))))))))))))))))))(((((.........)))))))))).))))).)..))))..))))).)))))...)).)))))).))))........))))).)..))))..)))))).)))).))))).............((((.........)))).)))))))))))(((.((((.((((((.(.......)))).)))((((.((((((((..(....(((((........)))))......)..)))))))).))))...)))).)))......)))))))))))).))....)))))))...((((((......)))))).......((((.((((((((..((...))..)))))))).))))..(((((((.(((.((((.((..((((((.((((((......))))))..))))))..)).)))))))..))))).)).(((.((((....)))))))....))).))))))))..)))))))))))))((((((((((((.(((((.........(((((((..(((((((((((.(((((((((.((...(((..(((((..........))))).)))......)).))))..(((((((.((...))))))))).(((.((...)))))...(((.(......))))((((....))))..((((..(((((.(((....))).)))))...)).)).................))))).)))).))))..))).((((.....))))(((((((((((....((((....))))...))).......((((((((((((......))))))))))))...(((.((..(((....)))..))..)))((((((.(((((.....)))))))))))......)))))))).(.((((.((((((.................)))))).)))).)...((((((......(((.(.(((.....))).)))).......))).)))..((((((((...((..((....))..))..))))))))..........((((((.......))))))...........))))))).......((((........))))...((((....))))..))))).))))((((((((...((((((((((((...((((((((.(((.((((((((((.((((..................)))).))))).....)))))........))).)))).))))...))))))))))((((((((((....)))))))))).....))...))))))))............(.(((((.........))))).)))))))))......)))))))).......
Thermodynamic Ensemble Prediction
.,((((((((....))).)))))|(((((({((((((..({((((((,........((.((((((.(((((((..(((..(((......(((((......)))))(((((((((((((((((((..(((((((.(((((..(((((..(((....)))..)))))..)}}))).{{.{{{........|||{|}{{,{{{.}}})))}}(((((.((.....)).)))))..((((((.....))))))...)).))))).....)).))))))..))))))).))))..))}..))).)))}(((((((..((.((((((((((((..(((((((({(((............((((..((.((((.((........)))))).))..))))(((((((((.(((...(((..((((..((((((........((((.((((((.(({(,({,((((((.,....}.))))))...,,.(((((((((..(.((((((((((..(((((((..(((((.,,(({...,,)}.,},..((((((.{{.(((((((,{((((((||{|,.,.||..,,||,||{||.,.,,({{(,((,..,||||||((({{...,,)}}||(({,{.{||{.|,,.,,..)}))))),))))))))))),}}(((((((((({((((((((((,,......,.((((....)))).,..))))))))))........||,{|{{..,,.,..})))}.})))))))))))).......,,.,},...............))))))))))))))))))(((((.........)))))))))).))))).)..))))..)))))..}}},...)).)))))).))))........))))).)..))))..)))))).)))).))))).............((((.........)))).)))))))))))(((.((((.((((((.{.......})))},))((((.((((((((..(....(((((........)))))......)..)))))))).))))...)))).)))......)))))))))))).))....)))))))...((((((......)))))).....{.((({.((((((((..({...})..)))))))).,)))}.(((((((.(((.((((.{{..((((((.((((((......))))))..))))))..}}.)))))))..))))).)}.(((.((((....)))))))....))).))))))))},})))))}))))))((((((({({(.,(((,{,,,{,,,.|||||{|{,}|{{|||{((((.(((({((((.{(...(((..(((((..........))))).)))...,..)).))))..(((((((.{{...}})))))))..,{{((.,.||||....||,.|,.....|}}}((((....))))..(({{..(((((.{({....))}.)))))...)).}}.........,,.,....))))).)))){||||.{|,,{(((({,,..{{||{((({....,.,}}.}}||.)))})))}}.})}...}}}}|(((((((((((......)))))))))))}.,,(((.{({.,,({{,{|||{.||{{|||((((((.(((((.....}))))))))))......{||||(({{{......}))))),.......|||||||..{{{((((((((...(((..{{.....{(({...,)))..,..}}..)))...))))))))..))},((((((((...{{..{{....})..}}..)))))))}.,........{(((((.......))))}},..,.........},..,.......,,|{,,,}},..,||,..{({{,..,|}}}..,},))})))),||||||||,.}||,|,||||((({..{(((({{{(((({{{{{{{{{{|,{{{|..................}}}}.|}))}....,||,,.........||||||,,,||||...,)))))))))|||{{{{{{{....,}|||||}}}..,}}))...}}}}}}))}},}}}},}}}}}}}|,|}},}.,{{{,...))))))))))))......,))))))}.......

Transcripts

ID Sequence Length GC content
GGGAGGCCCACGUAUGGCGCCUCUCCAAAGGCUGCAGAAGUUUCUUGCU… 2154 nt 0.5432
Summary

This gene encodes a type III intermediate filament protein. Intermediate filaments, along with microtubules and actin microfilaments, make up the cytoskeleton. The encoded protein is responsible for maintaining cell shape and integrity of the cytoplasm, and stabilizing cytoskeletal interactions. This protein is involved in neuritogenesis and cholesterol transport and functions as an organizer of a number of other critical proteins involved in cell attachment, migration, and signaling. Bacterial and viral pathogens have been shown to attach to this protein on the host cell surface. Mutations in this gene are associated with congenital cataracts in human patients. [provided by RefSeq, Aug 2017]

Forensic Context

A study in mice and rats demonstrated that the VIM is a sensitive marker for reactive astrocytosis after traumatic brain injury, with its immunoreactivity and mRNA levels increasing post-trauma, starting at one day and peaking around three days, showing a widespread response especially in white matter distant from the cortical lesion [Ekmark-Lewén et al. DOI:10.3233/RNN-2010-0529]. In a separate transcriptomic study of rat cardiac fibroblasts, the VIM was utilized as a broad marker to confirm fibroblast lineage in cultured cells [Perreault et al. DOI:10.1152/physiolgenomics.00074.2021].