Basic Information

Symbol
VNN1
RNA class
mRNA
Alias
Vanin 1 Tiff66 Pantetheine Hydrolase Pantetheinase Vascular Non-Inflammatory Molecule 1 EC 3.5.1.92 Vannin 1 EC 3.5.1 Vanin-1 HDLCQ8
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_004666.3
Sequence length
3853.0 nt
GC content
0.3950

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1010.00 kcal/mol
Thermodynamic ensemble
Free energy: -1084.61 kcal/mol
Frequency: 0.0000
Diversity: 939.95
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..........(((((((((((...((.((((((((((.((....(.((((((.(((((....((((.((((.((((.((((((.((((.....)).)))))))))))).)))))))).))))).))))))).......(((((...((((.(((((.....))))).))))...................((((((((((.....(((........((((((.(((((.((((.((((......))))))))..((((..((((....)))).....))))....((((.((.(((((........)))))))..)))).....((((..((((((((((..((((((((.(((......)))((((((((....((((..............)))).))))))))..(((((.........))))).......((((((..(((((.(((((((((......(((((((((.(((((.....(((((((((........))).((((.((((...((((...))))((((.(((((((.((((((......)))....((.......))(((.(((((..((((......(((((((((..(.(((((((((((((((........))))))))...(((((......)))))..............)))))))).)))....)))))))))).))))).))))))..))))..))).))))((((((((..(((((((((......)))))))))))))))))....))))))))....))))))))))))))))))))......))))...............((..(((.......)))..))..))))).))).))..))))))((((...((((..((((((..((...((((((((.((((((........)))))).((...((((((((...((((((((((....))))).))..)))..((((((((..(((.((......)))))..))).)))))....))))))))...)).)))))))).))))))))(((((....)))))))))..))))))))))))..)))...)))))))))))...)))))))))))........))).))))))))))(((...((((........))))...))))))))(((((((((((..((((..(((((((.((......)).)))))))...))))..))))).))))))......................)))))))))((((((((.....(((((((((((....(((((((((.((((((((((((((.((((...((.....)))))).)))))))))))))).))...((((.(((((((((((....)))))))).)))))))(((((.........)))))........(((((((((.((((((((((.....)))))((.((((((..((((.........(((((...)))))))))..)))))).)).....((((...((((((.(((((.......)))))..)))))).)))).....((((((((...))))))))((((((((((.((((((.............)))))).))).)))))))..))))).))))))))).............(((((.........)))))((((.(((......))).))))..........((((((((.............))))))))..(((((((.((((.....)))).))))))).))))))).((((.....))))(((((((.(((......))).))).))))...((((((....)))))).........(((((.(((((((((..((...(((.((((((.......(((((.((....)))))))......)))))).)))..............((((((...))))))...............((((((((((((((.((((((((((.............((((((..((((((.......(((..(((((((.......((((((.((((......)))).))))))........)))))))..)))....))))))))))))..(((((((((......................))))))))).......)))))))))).)))))).))))))))....((((((.....(((((((...((((..(((............((((((((...((((....(((............)))......))))..)))))).)))))..))))..((((....(((((....)))))...))))..))).....(((..((((.((((((((((....))))))))).).))))..)))....)))).....)))))).....))..)))))))))))))).....((((((.......))))))))))))).))))..))))))))(((((((((.....)))))....)))).......))).))...))))))..((((..(((((....))))))))).........((((((..........))))))))))).......(((.((((((((((((((.......((((((((........((((((((...(((((((((.(((.(.(((((((((((.......))))).................(((..(((((..........(((((((......)))))))(((((........)))))(((((((........(((.(((.((((((((((......))).)))))))....))).))).((.(((.(((....)))))).)).((((((((....((..(((((....)))))..)))))))))).........)))))))..((((((((................(((((((((((((((((.(((((((((..(((((.((((((((...................))))))))....)))))...........(((((...(((((.....))))).)))))..............((((((.(((((.(((...((((((((..((((((.......))))))..))).......)))))....)))))))).)))))).....(((((.....(((((((.......(((.((.((((....)))).))))).)))))))......)))))...............((((((.((((((((((((..((((((((((.(((((....)))))))))))))))..)))))))))))))))))))))))..)))))))...(((....((.((((((((((.(((((((.(((.((((.......))))))))))))))..(((....))).))))).((((((((((((.((((((...((...........))..))))))...)))))))).))))....)))))))...)))........)))))))))))))).)))))))).......))))).))).........((((....))))......(((((((((....((((((((.....))))))))..(......)))))).)))).......)))))).)))).)))))))))...)))...((((((..(((((((((((((((((.(((((((((......)))))))))...((((.....))))(((((...((((((..((((......))))....)))))).))))))))))).))).))))))))...))))))...)))))........))))).)))..........(((........))).......))))))).)))))))..)))...
Thermodynamic Ensemble Prediction
..{{{{{((((({.,.((((.(({,,..|}}|||}|{,|{....{.((((((.(((((....{(((.((((.(((,{((((({,((({.....}).)))))))))))).)))))))).))))).)))))),.,{(((({(.{,...((({.(((((.....))))).}))),.,,,..{,,,{{{..{{{{{{{{{{{{{,..,,,({,{{{,,,,((({{(,{,{((,((({,((((......)))).}|||,({{{.,{{{{....}}})}}},.||||....((((.,{,(((((........)))))),..)))).,,,.{|||.,|,,{({({{{,.|((((,,..{{{....,,)}}{(((((((....((((....,.....,}..)))).)))))))},.{{{{{.........))))){{{....,{{({{,.|||{,.||||{|{||..,,.}||{{|{|||,||||||},,,||{|||{{,.,,....,|,,.||||,||||},,||||,,,,}}|({{,.,||||||}||,(((......)))....,,.....,}))|||.,,,,,.,((((,,{{,.{{{{(((((,{((({(((((((((((((........))))))))...{((({......)))))..{{.....,..,,}}|}}||{{{{|||{.||}||||||..|,,,|{|,,||)|,))))}..)).,}}}((((((((..(((((((((......)))))))))))))))))....||||||||..{|||,,|||||}}|||||||}|.,,,{{|}||||..........,,.,{..{{{......,))}.,)).}}))}|.}}}.))}.},,,,,((((((....(((......)))...)))))}.(({.(((((.....,}})),))).||...{((|{,,|,,,||||||||,.,,,.))))).}}..})).,((((((((,.{{{.||,,,,,,)}})).,))),)))}),,..,|||||||{{{||.,,)))))).,,..}))}}}}((((((((({...)))))))))),)))))}.}}}...,}}},||||||..{|||,|||||||{.,,,...|},.}}}}}})}||,(({,{(({{..,,||..||||...|||{||||(((((((((((..((((.,(((((((,(,......,,.))))))).,.))))..))))),))}))}.......,,.......,{{{,.,,}}}|,{.((((((((.....(((((((((((....(((((((((.((((((((((((((.((((...{,.....,,)))).)))))))))))))).))...((((.(((((((((((....)))))))).))))))){((((.........))))}........(((((((((.((((({((((.....))))}{(.((((((..{(((,........(((({...})))))))),,)))))).)),....((((...((((((.(((((.......)))))..)))))).))))....,((((((((...))))))))|(((((({((.((((((..,,....,}...)))))).})).))))))}..))))).)))))))))............{{{{||,,,{.,...}}}},|,||.{||....,,))).})))..........((((((((.{,.......},.))))))))..(((((((.((((.....}))),))))))).))))))).((((.....))))(((((((.(((......))).))).))))...((((({....}))))).........((({(((((((((((..,{...{{{.((((((.......((((((((....)))))))......)))))).}}}....,,........((((((...))))))...,,,,........((((((((((((((.((((((((((.,,,...,,,...,,,|||..{(((((.,{{{..(((..(((((((.....,.((((((.{(((......)))}.))))))........)))))))..))),},,))))))}}},,,..(((((((((..,,.............,||..))))))))).......)))))))))).)))))).))))))))....{|||||.....,((({,...,{(((({((,...((((((.........)})))),(({.,{,.,......{{{...||{{(({{{.....{{{.||{{{{....,.||...((((.,,.(((({....}))))...)))).,).,....}|||}},|||.,,,||||,||}}}.,,))),,,,.,.,}},..),}}}.,)))).,},,)))))}.....,}..)))))))))))))).....((((((.......)))))))))))))}}))}..))))))))|{{((((((.....))),)},..}))}..|{{{{|||..(((({.(((((((.((.......,).)))))))............((((((..........)))))))))))..,}}}}}}}.{{{{||,,,||{||,|,,}}}|}|||||}|},..}}}}|,))))))})))}}.}}}}},...|}|}}}}}}}||,.......,,,,,...,...........(((,,((..((((((((((((((((((((......)))))))({((({,{{....,},,}{{{{{{{........(((.(((.((((((((((......))).)))))))....))).))).,{,{{|,{{{....)))))}.}}.,,,,||||,,..,({{(,,,.{{{{{||||{{,,},,||||{{.....,,,|,|||,,..((((((((.....,,,........(((((((((((((((((.(((({(((({.{(({,.(((((((({{...........},,...})))))))....}}|||....,{{,{{{(((((...{{{{{..,,,)}))),,))))..............((((((.(((((((((.,.({{((,((..(((.((..{{,.....}}},...)})))..,))))}..,.)))))))).)))))).....(((((.....(((((((,......{((.((.((({....}))),),))}.)))))))......)))))...............,(((((.((((((((((((..((((((((((.{((((....))))}))))))))))..)))))))))))))))))))))))..)))))))}|,(((..,.((.((((((((((.(((((((((({{((((.......))))))))))))))..(((....))).))))).((((((((((((.((((((...{(.,......,,.))..))))))...)))))))).))))....))))))),..))).,......,))))))))))))).)))))))).....,,,,}|||}|||}}}}....)))})))})))...}}}}(((((((((.,,.((((((((.....))))))))..,......,))))).)))}.....))))))).....))))))..)))))))}}},.{(((((..(((((((((((((((((,(((((((((......)))))))))...{(((,,,,,|||},{(((...,((({(,.((((......)))).,,.})))}}.}}}}))))))).))))}}))))))...)))))).{{||,,.{{{{....)).))...}}}}.......,,,..,}}}}}))),......,,,,,,,..}}}}}}........

Transcripts

ID Sequence Length GC content
AGCACUCAUUGGACUUCAGCAUGACUACUCAGUUGCCAGCUUACGUGGC… 3853 nt 0.3950
Summary

This gene encodes a member of the vanin family of proteins, which share extensive sequence similarity with each other, and also with biotinidase. The family includes secreted and membrane-associated proteins, a few of which have been reported to participate in hematopoietic cell trafficking. No biotinidase activity has been demonstrated for any of the vanin proteins, however, they possess pantetheinase activity, which may play a role in oxidative-stress response. This protein, like its mouse homolog, is likely a GPI-anchored cell surface molecule. The mouse protein is expressed by the perivascular thymic stromal cells and regulates migration of T-cell progenitors to the thymus. This gene lies in close proximity to, and in the same transcriptional orientation as, two other vanin genes on chromosome 6q23-q24. [provided by RefSeq, Feb 2009]

Forensic Context

A study in humans identified Vanin 1 as one of the top ten upregulated differentially expressed genes in peripheral blood samples from myocardial infarction patients compared to healthy controls [Zhao et al. DOI:10.3892/etm.2017.5580].