| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACGCGCGGGGCGGGUGCUGCUUGCUGCAGGCUCUGGGGAGUCGCCAUGC… | 6776 nt | 0.4169 |
This gene belongs to a group of vacuolar protein sorting (VPS) genes. The encoded protein is a component of a large multimeric complex, termed the retromer complex, involved in retrograde transport of proteins from endosomes to the trans-Golgi network. The close structural similarity between the yeast and human proteins that make up this complex suggests a similarity in function. Expression studies in yeast and mammalian cells indicate that this protein interacts directly with VPS35, which serves as the core of the retromer complex. [provided by RefSeq, Jul 2008]
No relevant information is available at the moment.