| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCUCACAGCUAUUGUGGUGGGAAAGGGAGGGUGGUUGGUGGAUGUCAC… | 8830 nt | 0.5847 |
This gene encodes a glycoprotein involved in hemostasis. The encoded preproprotein is proteolytically processed following assembly into large multimeric complexes. These complexes function in the adhesion of platelets to sites of vascular injury and the transport of various proteins in the blood. Mutations in this gene result in von Willebrand disease, an inherited bleeding disorder. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Oct 2015]
A study in human corpus cavernosum tissue demonstrated that the VWF is a highly expressed protein marker used to identify endothelial cells [Zhao et al. DOI:10.1038/s41467-022-31950-9]. Another single-cell RNA sequencing study of human erectile dysfunction tissue confirmed its expression in endothelial cells and noted specifically high expression in a fibroblast subcluster exhibiting endothelial signatures [Fang et al. DOI:10.3389/fendo.2022.874915].