| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUCGUUGCCAUGGAUCCUGGGGACGACUGGCUGGUGGAAUCCUUGCGCU… | 5331 nt | 0.4821 |
The protein encoded by this gene is thought to contain multiple WD40 repeats. WD40 repeats are motifs that contain 40-60 amino acids, and usually end with Trp-Asp (WD). This protein is found in the cytoplasm during interphase, but accumulates at the spindle poles and astral microtubules during mitosis. Reduced expression of this gene results in abnormalities in the size and morphology of the nucleus. Mutations in this gene have been associated with Galloway-Mowat syndrome PMID: 25466283), which is a rare autosomal recessive disorder that affects both the central nervous system and kidneys. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
A study in mice demonstrated that acute alcohol exposure during neurulation induces rapid transcriptomic changes in the rostroventral neural tube, with WDR73 being down-regulated 2 hours post-exposure [Boschen et al. DOI:10.1016/J.Alcohol.2022.09.001].