| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAACGGGAACAGCCCUGGCUGAGGGAGCUGCAGCGCAGCAGAGUAUCUG… | 1977 nt | 0.4390 |
The protein encoded by this gene functions to inhibit WNT proteins, which are extracellular signaling molecules that play a role in embryonic development. This protein contains a WNT inhibitory factor (WIF) domain and five epidermal growth factor (EGF)-like domains, and is thought to be involved in mesoderm segmentation. This gene functions as a tumor suppressor gene, and has been found to be epigenetically silenced in various cancers. [provided by RefSeq, Jun 2010]
A study in zebrafish and mouse demonstrated that the WIF1 transcript, a WNT inhibitor involved in development and cancer, increased in relative abundance at 0.3 hours postmortem in zebrafish [Pozhitkov et al. DOI:10.1098/rsob.160267].