| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGGAGAGGAGAGGAGCGGGCCGAGGACUCCAGCGUGCCCAGGUCUGGCA… | 1641 nt | 0.5545 |
The protein encoded by this gene may be involved in the innate immune response to bacterial exposure in the mouth, nasal cavities, and lungs. The encoded protein is secreted and is a member of the BPI/LBP/PLUNC protein superfamily. This gene is found with other members of the superfamily in a cluster on chromosome 20. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the BPIFB1 serves as a specific mRNA marker for trachea tissue identification and is utilized in targeted massively parallel sequencing assays for this forensic application [Haas et al. DOI:10.1016/j.fsigen.2021.102486]. This review further notes that the BPIFB1 is among the mRNA markers used for tissue identification in forensic transcriptomics, which facilitates source tracing of biological materials from crime scenes [Lei et al. DOI:10.1093/gpbjnl/qzag007].