Basic Information

Symbol
BPIFB1
RNA class
mRNA
Alias
BPI Fold Containing Family B Member 1 LPLUNC1 VEMSGP Von Ebner Minor Salivary Gland Protein C20orf114 Long Palate, Lung And Nasal Epithelium Carcinoma-Associated Protein 1 BPI Fold-Containing Family B Member 1 DJ1187J4.1 BA49G10.6 MGC14597 Long Palate, Lung And Nasal Epithelium Carcinoma Associated 1 Chromosome 20 Open Reading Frame 114
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_033197.3
Sequence length
1641.0 nt
GC content
0.5545

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-602.20 kcal/mol
Thermodynamic ensemble
Free energy: -627.56 kcal/mol
Frequency: 0.0000
Diversity: 283.46
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((((.((((...((((((((((.(((((.(((..((((...((((....((....)))))).)))).))))))))(((.((((..(((.(((((((..((........)).))))))).))).)))).))).............((((((...)))).))......)))))))))).................(((((((((((..(((((.((((((....(((((..((((..((.((((((....))))))))(((((((((((......((((((((.((...))))).)))))(((((.((((....))))(((((.......((((.(((((((.(((((((.(((((..........)))))..))))..))).))))))))))).))))))))))..(((.((......)).)))(((((((((((.........(((.(.((((.....(((.((((....)))))))..))))).))))).))))))))))))))))).)))..))))..)))))..........)))))))))))..))))).((((((....((((((.((((((......))).)))...))))))....))))))......))))))..(((((..(((.((......))..))).)))))......((((((...(((((((((.((......(((((((((.(.((((((((...............((((((((((.((((.......))))))....(((((((.((((((.(((((((.(((((((((((.......))))).))).......(((((.....)))))..(((((((((((.(((..((........))..))))))))))))))((((((((((((((((.(((......((((((........))))))......)))..)))))).......).))))))))).(((((.((.((.(((((..((((....((.(((((....))))).))..))))..))))).)).)).))))))))))))))).)))))).).))))))....))))))))....((((((((...(((((((((((((((.....((((.(((...))).))))))))))).......((((((......))))))...........((.(((((((......((((((((........((((............)))).....((((((((((((.....((((...((((...))))...))))..................((((((((..(((...))).))))))))...)))))).))))))(((....)))(((((((......))))))))))))).)).....))))...))).))(((((........)))))......)))))))))))))))))))))))).).))))))))).....)).))))))).))..))))))..(((((....))))).((((((((((..(((((.((((..((((((((.((((((((((.(((....))).))).)))........)))).)))))))).))).).)))))..)))).))))))........)).)))))))))............(((......))).
Thermodynamic Ensemble Prediction
.(((((((.((((...((((((((((.{((((.(((..((((...((((....{{....)))))).)))).))))))))(((.((((..(((.(((((((..{{........,}.))))))).))).)))).))).............((((((...)))).))......)))))))))).....,{......,...((((({(((((..((((,,((((((....(((((..((((.,((.((((((....))))))))|((((((((((......((((((((.((...})))).)))))(((((,{(((....}}},{{{{{.......{(({.(((((((.(((((((.(((((..........)))))..))))}.})).)))))))))))|)))},)))))..(((.{(......)).))){((((((((((.........(((.{.((((.....(((.((((....)))))))..))))).))))),,)))))))))))))))).))}..))))..)))))..........)))))))))))..))))).((((((....((((((.((((((......))).)))...))))))....))))))......})))))..(((((..(((.((......))..))).)))))......{(((((...(((((((((.((..,...(((((((((.{.(((((((({,...,{{{{.....||||(((((({,,,({{{{{{,...,||,...(((((({.((((((.(((((({,((({(((((((.......)))))}})},,..,,,((({{..,,,))))}..(((((((((((.(((..((........))..))))))))))))))((((((((((((((((.(((......((((((........))))))......)))..)))))).......),))))))))).(((((.((.((.(((((..((((....((.(((((....))))).))..))))..))))).)).)).))))))))))))))).)))))).).))))))...,))}}}}}}....|{((((((...{{((((((,{{,,||||..{((((.(((...))).))))}.............((((((......))))))...,,|,,|,.((,(({,({(,,,,.,,,,{|{||}||,.,,,||{{...........,)))),,}..,|||||||{(({.,,||((({...((((...))))...,},}.....{{,...,)}....((((((((..({{...}}}.))))))))...,}}}||,}|||}|(({,.,.,,,(((((((......))))))),,}})),)},,,.,))}}|||,,,.},(((({........)))))...,..)))))))))))))))))))))))).).))))))))).....)).))))))).))..))))))..(((((....))))).((((((((((..(((((.((((..((((((((.((((((((((.(((....))).))).)))),......)))).)))))))).))},).)))))..)))).))))))........)).))))))))).,..........(((......))).

Transcripts

ID Sequence Length GC content
GGGAGAGGAGAGGAGCGGGCCGAGGACUCCAGCGUGCCCAGGUCUGGCA… 1641 nt 0.5545
Summary

The protein encoded by this gene may be involved in the innate immune response to bacterial exposure in the mouth, nasal cavities, and lungs. The encoded protein is secreted and is a member of the BPI/LBP/PLUNC protein superfamily. This gene is found with other members of the superfamily in a cluster on chromosome 20. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the BPIFB1 serves as a specific mRNA marker for trachea tissue identification and is utilized in targeted massively parallel sequencing assays for this forensic application [Haas et al. DOI:10.1016/j.fsigen.2021.102486]. This review further notes that the BPIFB1 is among the mRNA markers used for tissue identification in forensic transcriptomics, which facilitates source tracing of biological materials from crime scenes [Lei et al. DOI:10.1093/gpbjnl/qzag007].