Basic Information

Symbol
WNT3
RNA class
mRNA
Alias
Wnt Family Member 3 INT4 Wingless-Type MMTV Integration Site Family, Member 3 WNT-3 Proto-Oncogene Protein Proto-Oncogene Int-4 Homolog Proto-Oncogene Wnt-3 MGC131950 MGC138321 MGC138323 TETAMS
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_030753.5
Sequence length
3287.0 nt
GC content
0.5068

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1126.60 kcal/mol
Thermodynamic ensemble
Free energy: -1187.49 kcal/mol
Frequency: 0.0000
Diversity: 911.83
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
........((((.((((((......))).)))...((((((...))))))((.......)).(((((((...((((((((.((((.((.........)).)))((((((((((((((((((.(((((((((((((((((((((.((((((.((.....(((((((......)))))))...)))))))))))(((((...........(((((...)))))))))).((((((.......(((((.(((...))).))..))).......)))))).....))))))...(((((((((...(((...))).....))))))))).)))))).))).((((((.(((((((((....((((..(.(((....(((.(((((.(......).))))).)))...((((((((....((((.(((((...((((((((((..((((((...((....)).))))))(((((((.((.((........)))).))))))).......(((...((((((((((......))))....)))))).)))))))))))))..)))))..))))....))))))))(((((........)))))((((((((((((.(((.((((.(((((.((((((((..(.(((.(((.((((.........((.(........))).(((.((.((((..((((((..(((.((((.......)))).)))))).)))..)))).)).)))...((((....))))))))))).)))).)))))..)))))))))))).))))))))))...))))).))))..))))))))))))).)))).)).))).)))......)).))))).)).))))))..(((((((((((.......((.((((((...........)))))).))(((((...((((.(((((..(((((..((((...(((((((((((((((..(((((((((((...)))))))(((..((((...(((..((((((((((((.....(((........))).))))))))..))))..)))...))))..)))......(((((.....((((....))))))))).((((((((.((((......(((.(((.(((((((((......))).)))))).)))))).))))))))))))((((.((((...((((...((((((((((((((.......))...(.(((.((((........))))))).)((((...)))).........(((((.......))))).))))))))))))..........))))...))))...))))((.(((.((((((...)))))).)))..)).............))))..)))))...))).)).)))))..))))..)))))..)))))..))))...)))))((((....((((...(((.(((((....((((((.((((((........................(((((((.........(((((((((((......))).).)))))))..))))))).....)))))).))))))..................))))).)))....)))).)))))))))))))))(((((((((((((.((((.((.........)).)))))))))))....)))))).((((....))))........((((((((....(((((...)))))...)))))))).).)).)))))))))))))(((((.(((.(.((((((((((((((((....))))).((((..(((((((((.......)))....((((((((......))))))))....................))))))..))))..((((((((.((((((..(((((...............(((((..............)))))..............))))).............(((((((..((((.(((.......)))))))...((((((.........(((((((...((.((((...........)))).))........((((((((....(((((.........(((((((((((((((...))))............))))).))))))..)))))...)))).))))......)))))))....((((((((((((((((((...(((.....)))...(((...(((((.....)))))...)))(((((.....)))))..))))))))))......))))))))......(((((((....((((...))))....((((......))))))))))).(((..((((((.((((((((((((.....(((((((.((.((.....))))..))))))).......)))...)))..)).))))....))))))..)))..(((((((......))))))).(((((((....((((.((((((((((((((((((((((((..((.((.((((.................)))).)).)))))))....))))))...(((......)))..)))))))))))))))))......)))))))(((((((...(.((((((..(((((....)))))...((((........)))).........(((((...........)))))((((.........))))(((.((((((((((((((...)))).......)))))))))).))).......)))))).).......)))))))..((((....))))..)))))))))))))))))))..))))))))..............((((((...........))).)))...((((((.((((((((....((((((.(((((((((....((((((((...((((((((((..((((((((....(((((...))))).....)))).))))...))))).)))))))))))))....)))))..))))((((((..(((((.((((....)))))))))))))))))))))...)).))))))....)))))).)))))...))))))))))..))))).....((..(((((((((((....(((..........((((((((........))))))))))))))))))))))..))......(((((...)))))......(((.(((((......((((((((.....)))))))).......(((((((((...............))))))))).))))).))).....))))((((......))))....
Thermodynamic Ensemble Prediction
........((((.{(((((,,,.,,|||,,||...(((((,,..,}.))))}.....{|||,.|.((({{...,,{.,.{.((((((((.......(((.((((,((.,((..((({{(,,{{{,|||}..{{{|..||{((((((((.(((((((..(((((((......)))))))..(((((((((.(((((((..({.{((,,((((((((((({,,,,{{{.({(((({,..,{{{{(((.{(({(,|,,.|,...{{{{{....}||))}........|,|,|||,|||,,{(({(((({{({(({((..((({{{(((......))))))))..((((((((({(...,).))))))))).....{{,.,{{||.|.,,,|||||}}||,}}|||.{(((((((....((((.(((((...{(((((((((,,((((((...((....)).))))))(((((((.((,{{........}))).))))))).......,{{...((((((((({......})))..,.)))))).))))))))))))}..))))),.))))....)))))))|((({{..,,,,.,}}}}}|||||{((((({{(((,({((.((({(.{{{{{(({,,|.{||,{{{,||||,.||.....,,.,......,.}}}}|||}||.((((..{(((((..(((.((((.......)))).)))))).)))..)))),)),)))}},((((....)))))}})))},))}|.)))))..}}}})))))))),)))}|}}))}...)))},.,,.,},}}}}(((((((.{(((((.((......)))))}}..,}})))))))((((.((((...(((.((((((.(...((.((((((...........)))))).)),,)))))).....)))..))))))))....,|}}}}}}}}}{{((.,,,..}|||{((({{{...})))))},,|{{|,||,,..))),,,,,,},|||{,.,,..}))))})}).))..)))))).).))))))))).....)))))))(((((.((((..((.......)}.)))).)))))}.)))))))}}||..,.,}).,||||||,(((((((((......))).)))))).)))))).)).)))).)))))))))))||{.(((((((.((((((((({(((,(((,{{{{{,,,{{,,{.,,(((((((((({((.,,((({(((...||||,{((({((.{{{{{...,{,,}||||{{{(({,(((.(({{(({.....}}}(((((((..,.....,},||{.(((((({..},})))}))}..,.,,,{{{{{...,((,((......)).})),)))))),......,,,((((((((........)))))))).}||||||...{{,,|||||||}}.|||,,{{{{(((..,,|{|,,}},.........,.........,(((((({{.......{((((((((((......))),}.)))))))}.))))))},}}}..})))}))).)))))))))))))...,})}})),,)}||}}}}}}}))..||}}}|||({(((.(((((..(((({..(((((((,(((((((({{,,{,({{,(..((((((((.((({{((((...{{{........((((((((....(((((...)))))...)))))))){((((((((((((({,.{{({{(,{({(({((.((((,...(((.{(((((((((((((.((((.((,((((...}}}},)).,,,...)))).))))...))))))).)),.)))),,))))))})))).{{|,.||||.}..,))))}}..{{{{......}}))}))))))))))}(((((....,....,....)))))...............................)))))))).))))))))..).})}.))),..))),}))))....|,,,..|||{|||...{{.(({{,,,........}})).}}..,.....{{((({(|....{||||,,,||||,.(((((((((((((({...})))............))))).)))))),}))|||..,||||.}}}|,.....})}}}))....((((((((((((((((({...{{,.....}},...{((,..(((((.....)))))}}}|||(((((.....))))),,})))))))))......))))))))......,}))))))}})))}..{((|{{....((((......)))},,},}}},|,|,.,,|}}}}}},,}}}}}.}}}}}.,{((((((.{{,({....,))}},,))}))}|{((({..,|{.{(,.......)),))...,))))}},||||,(((((((......))))))).(((((((....((((.((((((((((((((((((((((((..((.((.((((.................)))).)).)))))))....)))))},...,(.,,...,}}.})))))))))))))))))......))))))){({((((|...{(({(((..{((((....))))),,,||||.......,)))).........(((((...........)))))((((.........))))(((.((((((((({,((....|||,...}..,)))))))))).))).......})))))||......})))}))}..,,,})))))).))))))).)))....,|,,,||..}}}}}....,}}}......,,|((((....}}}},........{(((((((((((.((((((,,{{{{(((((({(((((((((....((((((((...((((((((((..((((((((....(((((...})))).....)))).))))...))))).))))}))))))))....)))))..)))},{{({{..(((((.((((....)))))))))}}}})))))))).}})).))))))....)))))).....(((((,,((,,(((.,{({........}}}...},,....)))))))))))))))))}((((((((........))))))))(((((...((((.((({{((((({{(({.,(((((((...{({.{......}.}))..))))))))}))))))))))).))))...)))))................{(((.......)))).,},,,.,,...))))((((......))))....

Transcripts

ID Sequence Length GC content
AUUUCCAAUCUCAAGUGGACUUUGUUCCAACUAUUGGGGGCGUCGCUCC… 3287 nt 0.5068
Summary

The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 98% amino acid identity to mouse Wnt3 protein, and 84% to human WNT3A protein, another WNT gene product. The mouse studies show the requirement of Wnt3 in primary axis formation in the mouse. Studies of the gene expression suggest that this gene may play a key role in some cases of human breast, rectal, lung, and gastric cancer through activation of the WNT-beta-catenin-TCF signaling pathway. This gene is clustered with WNT15, another family member, in the chromosome 17q21 region. [provided by RefSeq, Jul 2008]

Forensic Context

A study in rats demonstrated that the mRNA for Wingless-type MMTV integration site family, member 3 (Wnt3) was significantly down-regulated at the lesion site at different time points following contusive spinal cord injury [Wang et al. DOI:10.1016/j.brainres.2015.07.052].