Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUUCCAAUCUCAAGUGGACUUUGUUCCAACUAUUGGGGGCGUCGCUCC… | 3287 nt | 0.5068 |
Summary
The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 98% amino acid identity to mouse Wnt3 protein, and 84% to human WNT3A protein, another WNT gene product. The mouse studies show the requirement of Wnt3 in primary axis formation in the mouse. Studies of the gene expression suggest that this gene may play a key role in some cases of human breast, rectal, lung, and gastric cancer through activation of the WNT-beta-catenin-TCF signaling pathway. This gene is clustered with WNT15, another family member, in the chromosome 17q21 region. [provided by RefSeq, Jul 2008]
Forensic Context
A study in rats demonstrated that the mRNA for Wingless-type MMTV integration site family, member 3 (Wnt3) was significantly down-regulated at the lesion site at different time points following contusive spinal cord injury [Wang et al. DOI:10.1016/j.brainres.2015.07.052].