| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCGCACACCCGCGCACCCGCGGCCGCAGGAGGGCCCAGCGACGCCGCCG… | 2996 nt | 0.6682 |
The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 96% amino acid identity to mouse Wnt3A protein, and 84% to human WNT3 protein, another WNT gene product. This gene is clustered with WNT14 gene, another family member, in chromosome 1q42 region. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that ethanol exposure during neural stem cell differentiation significantly altered the expression of key Wnt signaling pathway genes, with the WNT3A being specifically up-regulated at both the mRNA and protein levels in ethanol-treated cells compared to controls [Mandal et al. DOI:10.1007/S11033-015-3862-1].