| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCGCGGAGCUGGGAGCGCGAUGGUCGGCCGCCGAGGCGCGGCAAGAUGC… | 4005 nt | 0.5970 |
The WNT gene family consists of structurally related genes that encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It is expressed in gastric cancer cell lines. The protein encoded by this gene shows 75% amino acid identity to chicken Wnt14, which has been shown to play a central role in initiating synovial joint formation in the chick limb. This gene is clustered with another family member, WNT3A, in the chromosome 1q42 region. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the mRNA WNT9A is a target in a competing endogenous RNA network centered on the lncRNA MIAT in non-small-cell lung cancer (NSCLC), where its expression is positively correlated with MIAT and negatively correlated with miR-133a-5p [Zheng et al. DOI:10.2147/CMAR.S163395].