Basic Information

Symbol
WNT9A
RNA class
mRNA
Alias
Wnt Family Member 9A WNT14 Wingless-Type MMTV Integration Site Family, Member 14 Wingless-Type MMTV Integration Site Family, Member 9A Protein Wnt-9a Protein Wnt-14
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_003395.4
Sequence length
4005.0 nt
GC content
0.5970

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1758.40 kcal/mol
Thermodynamic ensemble
Free energy: -1826.39 kcal/mol
Frequency: 0.0000
Diversity: 1304.91
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((((.((((((((((((..(((.(((((((.((((..((..(((((..(((((((.((.((((((((.(..(((....)))..).)))((.((((((((((.(((....((((((...(((((((((.((...((((...((((((((..................))))).)))...)))))))))))))))....))))))......)))((((..(((((....))))).)))).)))))))))))).))))))).)))))))(((.(((((((.(((((((((.(.((((.((.(...((((((......((((.((((((((...((((...))))))))))))))))(((((.((.((((...((((((((((.((....))(((((....(((((......)))))....))).)).....))))))))))..((((((.((.....)))))))).(((.(((((((((((.((..(((((((((...((((...((((..((((....((((.(((((((.((.(((((((((((....((........))...))))).(((((......)))))...((((.(((((((((.(.(((((((((..((((.(((((....)))))...(((((((((....(((((((.((((.((((((((((...))))))(((.((.((.((.((((.((......)))))).)).)))).)))...))))..))))))))))))))))))))))))..)).(((.(.((....)).).)))((((((((.(((((((((((..((....))..))))))((((.((((((.(((...((.(((((.((((((((.(((((((((((.((.(((((((...))))))))))).)))).)))..(((((.((.((..((..((.((((((.......)))))).))..))..)).))))))))))))))((((((((...((((........))))...))))))))((((((....))))))..........)))))))).))...)))))))))..))))((((.((((.(((((.((..(((.(((((..(((.(.((.(((((....(.((((....)))).).(((((((((..((((((.(((((..((((((.....)))))))))))((((.(((((.(((((....((((..((((.(((.(((((.(...((((......)))).))))))..)))))))..))))....))))).)))))))))(.(((((..((((.(((((((((((....))))))).)))))))).))))).).....))))))))))))))).))))).)).).)))..))))).)))))))))).)))).)))).))))).....((((((....((((((((((((((((((..((((..((((((..((((((....)))))).....)))).))..))))))))))))....))))))))))))))))..(((.(((((.(((((.....)))))..(((((((.....)).)))))((((.((....((.((((..((.(((((.(((((((...)))))))...))))).))...........)))).))...))))))....))))).)))..(((((((((((....))))...)))))))..)))))))).)))))))...).)))))))))...))))......)))))).))))))).))((((((.(((((..((((..(((((((((((.(((.......))).))))))..)))))..)))))))))))))))....((((((((((...)))))))))).(((((...(((((...((........))....)))))...)))))..))))....)))))))).....))))((((((((....))))..))))..))))))))).....))..))))))))))).))))))).))....(((((((.(.((((((...)))))))))))))).)))))...((((....))))..........((((.(((......))).))))))))))))).))))).)))).)))(((((.(((..(((((((...........)))))))..))).)))))......(((((.(((((.............((((((((((.(((......)))))))))))))..))))).))))))).))))))).)))))))).....))..)))))))))))...)))))).)).((.((((((((.(((.(((((...)))....((((((((((((((..((((..((((((...((((..((((((((((....(((.((((((((.(((.....(((((((....((.((.(.((((((....((((((((((...((((...))))...)))))(((((.((((((((..(((((((...)))))))(((....))).((((((..((..((((((.(((((....)))))(((....)))(((((((........)).))))).))))))..))..)))))).))).)))))..)))))))))).(((((((...((((((((((((((((((((((..(..(((.(((..((((..((.((((((..((((((((.(((((.(.((.((((((((..((((((...(((((((((((((((((((((......((((((((.(.((....)).).)).)))))).(((((((((((((......))))....))))))).))))))).)))))..(((((((.....((((((...(((((((((((((((..(((((((((((.......(((.(((((....))))).)))....)))))))))))((((((((((.....)))))))))).(((((.....))))).......................)))))))))))))))...))))))..(((..(((((((((......)))))))))..)))..(((((((((((((((...((((..(((..((((....(((...))))))))))..)))).)))))))))..(((..((.((((.((((((((.(((......((((((((((.(((..((((((...))).)))..(((((((((.....))).))))))...)))..))))))))))))).))))..)))).)))))))))(((((......))))).)))))).))))))))))))).))))))))).))..)))...))))).)).).)))))...)).)).))))((((((((..(((((((((.....))....((((((........)))))).(((((((((((....)))))))))))...))))))).))))))))..)))))).))..))))))).)))..)..))))))))))))))).(((((.....))))).....)))).))).))))))).....)))))).).)).))..))))))).......))))))))))).)))................((((((....))))))......(((((((.......)))))))...))).)))))))...))))..((((......))))......(.(((((((((..((((.....))))..))).)))))).)(((((((....)))))))))))))))))..))))...))))))))))....((((((.(((.(((((((.......((((((((........(((((((((......)))).)))))......)))))))))))))))))).)))))).)).))).)))))))).)).))))))).)).))))))))...........(((((((....(((.(.(((......))).).)))..)))))))((((((((((((((....(((((...))))).(((........))).....))))))))))))))...........
Thermodynamic Ensemble Prediction
((((((((((.((((((((,,,(({(((((((((((.(,((({{({,{{{((.,((({({{{({{(((({((((((((({,(((((((((.((({,.((((((((((.(((..{.((((((...(((((((((.({...((((...((((((((.,................))))).)))...))))}))))))))))....))))))......)))((((..(((((....))))).)))).}))))))))}}}.|||||||{{|..,}}|||||||}}.,,,}}))||||}|.|})},|({((....,,,,})}}..(((,{((((((((,..{(((...))))))))))))))))))).)))))))))..,|,)))))))|,}}.,.,))}.|||,,..,{|,|},.,}}}}}})}}.}))).,}.)))}))).)))),)}}((((((.((.....)))))))).({(,((((,((,,((..((((((((((((..((((((((,,....|||....}}}.,.(((((.(..(((((((((((((....((........))...)))))..(((.(((.(((....))).))).)))(((({.....{,|||((({{({{{,(((((....))))).,.,{|||||||}}.,.,,{,||}||,,,((((((((({...||||||{{,,(({((.{,{(,(({(,,.{{{{||,},|{||{,|||,|||,..,)))}})),))))),}}}))))))})}))),.)),{((.{.((....)).).))}.||||||,.,|||||.,..|,))}))..,}..,({(((.....)))})}))))..))))))))..).)))))))))))))...))))))||)))))..})))}))))))).|(((((.((.,,,||.,|}}}}.,,{.{((((.(({,(((,.((,,((((((((((((,,.{((((((,{.....}}.)))))).,.).))))),....((.(.(((....))).).)).)))))))...}}..}}}})),)))))),{{{{.||{{,{(((.((((((.((((({.{(.((((({.((((.(((((..(((.(.((.(((((....(.((((....)))).).(((((((((..((((((.{(((({,((((((.,,,.}}|||||}|||({{{.(((((.(((((....((((,{,((({(,({{{(((.{...((((,.....))))}})))))}.)))))}}..}))).,,.))))).)))))}}}},,|||.|||||{{.(((((((((((....))))))).)))})))),)})}}.}}},,,))))))))))))))).))))).)).).)))..))))).)))).}))}{({.(((((((((((((....}}),}}......)))))))).})}))}),}},)))}.)))))).)))}{{(((...((((({.....,.))))))))))}{((((((((((|.|||||{|,}}}|||||{{,{({,..,|||||}}}.{{(({...((((({{{,...}}})))))})}}}(((,....,})),,|||,(((((.(((((((...)))))))...))))).||,,|,{{|,.{{|{{{{,....||||,.,}}.{{{{.,,{{{..,,.})).,.}}}},((((((.((((((.(((((((((,,,,(.{{{({(((({(({{.....))))|.,.....,,,||,...,}))}}}})))))},,,)))..)))))).)))))))))))).,)))))))))}})})))).)))))))))))},}|{(((((.((((((((((((((...))))))))))((((({{{((((((((((....{{....)}....))))((((((((..(((.(((((...{{(((..{{{(((({,.((({{{{{||||{,.((((((({{{..{,|,,..}}}.((((((((...)))))))))))))))(((((((.{.((((((...))))))})))))))....,,..}}|}||}}}}).,...........|,,}|||..,.((((((....((((((.((.(((...))).)).)))))).)))))},))))))}....}))}}((((((((.(((({{.{{{{....(((((.{((((.............{(((((((({{(((......)))))))))))))..))))}.))))).(((((((.((((,({{,,{,..{({{{((.{((((.(((,,.(((((({|{{(((((((...)))))))(((...}))....,.,,(((((((,,((({(((,{((({,(((((.(({...}}).))))}....}}}}})),},},},.)}},,)}},,,.((.((((((((.{,,((((...{,...(((((((...((,.,....,)})...))))))}.(({.(({.(((((,,,...))))),)))..}}.}}}(((..((((((.{(,...}))))))))..))).)))}...,,)))))))).)),,,.....,},))))))).)))).)))))))),)))).})),)))),)))))))..((((,,(((,,{{{{{,(((((((((((((((..{..(((.(((.{(({{..((.((((((,{,,{((((({,,((((,.,,..}}}}((((((,((((((((,.(((((((((.,({..,},}))))))))..|,...,{{|.|,||,{{||,|{{(....))||(((({((({,.,.,|||,,{.||||||||||||.{{{{{{((((,{,(.((({,,,,((((((...(((((((((((((((,.{((((((({,,{{{.,..(((.(((((....))))).))).,.}))}}}}}|}},((((((((((.....)))))))))).(((({........,...,,,,,,.....,,,,,,,,,.}))))))))))))))...))))))..(((..(((((((((......)))))))))..)))..,{{,,((((((((((...((((..(((.{((((....{{{...)),)))))))..)))).)))))))))},(((.,(({({{{.((((((((.(((......((((((((((.((({{(((((({..|||,||,..,,,||||||}}}.}))).,,,,,,...)))..))))))))))}}}.))))|,|)}}.))))),))){((((......))))).|||||,...,|||}}||,}}}})),,,))))})))))))),}))}))))})}))))))}))})))))))}))}))),)}}}})(((((((((..((.......))..)))))))))||{,.(((((((((((....))))))))))})),,,,})))}.}),,,,)},)))))).))..)))}))).)))..}..))))))))))))))).||{{{..,,.)))))......)))},...)))),)).))))))))))))..|{|.,,{,,,....,..,},.}}},{{.{(((({..,|,,.....,.....{((((,....})))},......(((((((.......)))))))}))))).))}|......,,.,,.{(((......))))...))))))))..)}}})))))(((((.....(((((.{..,.(((.((((......)))).))),.).)))))....))))).)))))))))))))((((((.(({{((((((({....,,((((((((.....,..(((((((((......)))).)))))......))))))))}))))))))).)))))))))).))))))))),)))),))))))).)).)))))))).,,..,,{,,{(((((((..,.(((.{||({.....|})).)})))..))))))||{{{{{((((((({...,{{(({.,,.,,...{{{....,,..}))...,,})))))))))))}}...........

Transcripts

ID Sequence Length GC content
GCGCGGAGCUGGGAGCGCGAUGGUCGGCCGCCGAGGCGCGGCAAGAUGC… 4005 nt 0.5970
Summary

The WNT gene family consists of structurally related genes that encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It is expressed in gastric cancer cell lines. The protein encoded by this gene shows 75% amino acid identity to chicken Wnt14, which has been shown to play a central role in initiating synovial joint formation in the chick limb. This gene is clustered with another family member, WNT3A, in the chromosome 1q42 region. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the mRNA WNT9A is a target in a competing endogenous RNA network centered on the lncRNA MIAT in non-small-cell lung cancer (NSCLC), where its expression is positively correlated with MIAT and negatively correlated with miR-133a-5p [Zheng et al. DOI:10.2147/CMAR.S163395].