| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAUAUCUCAGGACCCAGGACCAUGUGAUAUGGGCCCAACACCUGGAUGA… | 1206 nt | 0.4312 |
This gene is located in the nonrecombining portion of the Y chromosome, and expressed specifically in testis. The encoded protein interacts with ubiquitin protein ligase E3A and may be involved in male germ cell development and male infertility. Three nearly identical copies of this gene exist on chromosome Y; two copies are part of a palindromic region. This record represents the copy outside of the palidromic region. [provided by RefSeq, Jul 2008]
A collaborative study in humans demonstrated that the BPY2 was evaluated in a preliminary study but gave inconsistent results during singleplex testing and was not included in the final validated semen pentaplex [Haas et al. DOI:10.1016/j.fsigen.2012.10.011].