Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAGAGCAGUGAUAACUACCUGCCAGUGUCUCUUAGGAGUGAGGUACCU… | 5715 nt | 0.5003 |
Summary
Xanthine dehydrogenase belongs to the group of molybdenum-containing hydroxylases involved in the oxidative metabolism of purines. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. Xanthine dehydrogenase can be converted to xanthine oxidase by reversible sulfhydryl oxidation or by irreversible proteolytic modification. Defects in xanthine dehydrogenase cause xanthinuria, may contribute to adult respiratory stress syndrome, and may potentiate influenza infection through an oxygen metabolite-dependent mechanism. [provided by RefSeq, Jan 2014]
Forensic Context
A study in mice and zebrafish demonstrated that the XDH transcript increased in abundance postmortem, with its increase specifically noted in zebrafish [Pozhitkov et al. DOI:10.1098/rsob.160267]. In a separate study on *Chrysomya megacephala* larvae, the XDH gene was identified as an up-regulated transcript in response to dietary oils and validated via qRT-PCR [Zhang et al. DOI:10.1371/journal.pone.0063168].