Basic Information

Symbol
BRAF
RNA class
mRNA
Alias
B-Raf Proto-Oncogene, Serine/Threonine Kinase BRAF1 BRAF-1 V-Raf Murine Sarcoma Viral Oncogene Homolog B1 V-Raf Murine Sarcoma Viral Oncogene Homolog B Serine/Threonine-Protein Kinase B-Raf Proto-Oncogene B-Raf RAFB1 B-Raf Proto-Oncogene Serine/Threonine-Protein Kinase (P94) Murine Sarcoma Viral (V-Raf) Oncogene Homolog B1 B-Raf Serine/Threonine-Protein 94 KDa B-Raf Protein EC 2.7.11.1 B-RAF1 B-Raf NS7 P94
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_004333.6
Sequence length
6459.0 nt
GC content
0.4107

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1944.50 kcal/mol
Thermodynamic ensemble
Free energy: -2066.22 kcal/mol
Frequency: 0.0000
Diversity: 1902.72
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......(((..((((((.(((..(((((((((.((((((((((((((.(......).)))))).((((((...((((...((((((((((((((..(...((((((........(.((((((.(((((..((((.(((((.(((((.((((......((((...(((((((....((.....((.((((((..((....))))))))...)).....))......)).))))).)))).)))).))))).))))).)))).))))).)))...))).).......))))))...)..))))).)).)))))))))))..))))))))))))))...))).)))).))..)))......)))).))..)))................((((((((((.((((((((...(((((((((.(((((((...((((((((((......))).)))))))......((((((((((((((((........((((((((((....(((((.....((((.(((......)))...)))))))))(((((((.......)))))))))))))).)))...(((((...)))))........(((((((((((((((...)).))))((((..(((((.((((((..((((....((((....))))..((((..(((.(((....(((((......(((....))).((((((.((.........)))))))).)))))((((...)))).))).)))....)))).(((((((((.........(((((((.((..(((((...((((((.(((((.(((((.....(((((..(((((((..((((.((((....)))).((((..(((.((((...((((((.(((((..((...((.((((((((...(((((((((((...(.(((((.........))))).)...)))))))))))....((((.(((.((((....)))).))).))))..(((((((((...((.(((...((.((((((((((.(..(((..(((((((.(.((....)).).)).))))))))..).)))))))).)).)).(((((((..((((((...((((...)))).....((.........))..))))))....)))))))))).))...))).)))))).......))))))))...)).))...))))).))))))..))))..)))...)))).....))))....))))))).))))).))))).........)))))(((((...)))))........)))))).....)))))..)).))))))).......((((........)))).))))..)))))....)))).))).)))..)))))..)))).....((((((((.....))).)))))(((((((((((((.......(((((.(((((((..((.((((..............((((..(((....((((((((.((..........)).))).(((((.......)))))((((((((.........((((((((.......)).))))))..........))))))))((((.((((((.((((..........))))))))))..)))))))))....)))..))))...))))))..))))))).)))))......(((((.......)))))..........)))))..))))))))........)))).))))).....((((...(((.....)))....))))..))))))))))))..))))...(((((....)))))(((.((((((.((((((...((((....))))....))))))....(((((..((((......(((((.....)))))))))..)))))((((........))))..((((((((.((((((.....(((((((((((......(((((....(((((........((((((((((.(((((((((((...........))))....))))).(((((((........((((((((((((((((((((...((((.((((((((((.(((...((((.((((........((((((((........(((....)))(((((((.......((((((((....)))))))).......)))))))...))))))))((.......)).........)))).))))...))))))))))))))))))))))))))((((.((((((((....((((((..((.(((..(((.......)))....))).))..))))))...))))).)))))))..........((((.((((((....)))))).......))))..((((((.(((((..(((((((((((((((........(((....)))..((((........))))...((((((((....(((.((((((.....(((...((((..(((...................(((((((((((((((.((.......)))))))...........((((.(((((((....((((((((((((..(((((((.((((.((...((((((((((((((.(((.....((((((((((.((.(((..........((((..........))))(((.(((((...))))).)))..............(((((((((((((.(((((((((((.(((((((........)))))))...........((((((...))))))((((((((...)))))))).............(((((((.(((((..((((((.((((((.((((((..(((((((((.(....).))))....(((((((((.((((.(((.((((((((.((........)).))))).........)))...))).))))..)))))))))((((((.((((..........)))).))))))..(((......(((((((...(((((((((....)))))))))....))))))).......))).....((((((((..(((.....(((((((((((((((((((((((.......(((((((.......((((((........)))))).(((((((..((((((...((((((((((((((.((((.(...((((((((...((((....(((((((.((((.(((((......))))).))))))))))).......(((((((((....(((((..(((((((.((((((((.(((.(((((((..........(((....)))((((.........................))))......(((((((....))))))).))))))).))).))........)))))))))(((((........))))).))))..)))))..)))))))))...(((....))).........((((((........)).))))......))))....))))))))))))))))))))........((((((((((.(((((((.....((((((((...............))))))))..)))).)))...)))))).))))..........((((((......)))))).........)))))))..)))))).)))))))(((((.((((((.....))))))..)))))...((....))..((((((..(((...)))..))))))...)))))))...(((...(((((((((........(((.((((((((..((((((..(((((((.....(((.....(((((....(((.........)))....)))))......)))......)))))))))))))....)))))))))))((((.(((((((.......)))))))..))))............(((.((((...(((((((((((((((....)))))))......))))))))...)))).)))......((((.(((((....(((......)))......)))))......)))).((((((((((....))))))))))...)))))))))...)))))))).))).))))))).))))))))....)))..))))))))..)))))...))))))..)))))).))))))..)))))...))))))))))))))...)))).)))).)))).))))).......))).)).))))))))))...))).))).......))))))))))).....((((((((...........)))))))).(((((..((((....)))).)))))(((((((...(((.(((((.((((........)))))))))..................)))))))))))).)))).)))))))..))))).))))))))))))))))))......)))))))).)).......)))..))))..))).....)))))).)))....)))))))).....)))))))))).)))))))))).)))))))))))).......))))).......))))))).(((.(((((((.(.((....((((((((((((....)))))).(((((((...((..(((...)))..))....)))))))...........)))))))).).))))))).)))........))))))))))))(((((((...........)))))))..(((((((((...((((((((..(((((..(.......)..)))))...))))))))......((((((.....))))))...(((........)))((((((.....))))))(((((......((((((((((....))))))))))...)))))........)))))))))..)))))....))))).(((((((....)))))))...................((((((((((((((((((((((((((((((.((...(((.(((.(((((((((((((((((((((((.(((...(((((((.(((..(((((((.((((((((((.(..((((((((((.((((((((((.(((.((((((.((((((..(..((((((((.((..(((((((((((...((((((.(((((((((..(((((.((((.((..(((((.(((((((((.((((((..(((((((((.((((((((.(((((((.((((((((((((((((((.((((((((((.(((((.(((((....((((..(((((((.......))))))).(((((....((..(((...)))..))))))).........((((.(((((((((.....((((..(((((......((((((((.(((((....((((((.(((.((((((((.((((((...........(((.........)))..............................((........))(((((........)))))(((((........)))))(((......((((.......))))......))).......((((((((((.........))))))))))..((..(((((((((.(..(((((...))))).......(((((.(((((..........))))).)))))...(((((.((.........)).))))).).)))))))))..))))))))..))))))))..(((((....)))))..........))).))))))))))).)))))))).....)))))......((((.......))))....))))...)))))))))...))))))))....))))).))))).)))))))))))))))))))))))))))).))))))).)))))))).))))))..)))..)))))).))))))))).)))))..)).)))).)))))..)))))))))..))))))..)))))))))))..)).))))))))..)..)))))).)))))).))).)))))))))).))))))))))..).)))))))))))))))))..))).)))))))...))).))))))))))))))))))))))).))).)))...)).))))))))))))))))))))))))))))))(((((((((....(((...(.((((.(((((..(.((.((......)))).)..))))).)))).)....))))))))))))))))))))))).....)))))).))((((.......))))((((.....(((((((...)))))))..)))).)))))).........(((((((...)))))))..)))))).)))..............((((((........))))))((((.(((........))).)))).)))))))......)))))))))........................))))).)))...((((....))))..)))))))))).......
Thermodynamic Ensemble Prediction
..,,,.(({..((((((.(((..(((((((((.((((((((((((((((.,,.{,((,|{|,,.{||,,}}}}{{{{..,((((((((((((((..{{{{((((((.,......|,(((,(({(((((..((((.(((((.(((((.((((,{,...{(((...((((({{.....,,....{{.((((({.,((....))))))))...)).....))......)}.))))).))))})))).))))).))))).)))).))))).)))...))).,.,.....))))))...)}}))))).))}}))))))))))))))).))))))))))...))).)))).))..)))......)))).))..}))....,,.......|,,((((((((((..((((,...,((((({,((....))......((((((((((......))).)))))))......((((((({{{{,.,{.........,,,.,|}||,.)).})))}....((((((((((......,(({,...{{{((((((((((.......}))))))))),((((((......((((((((,{{..{{{,,,,,..,,,,,,,,(((((..,((((((((((..((((((((.(({{(({..,,....,.},,|||{{{.(({{{.,{,{{,.{(((((((.,{,.{((,,{..||},((((({{((.........)))))))).}||||{{((,..,}}}||||{||{,||{|}},.(((((((({..,..|{,.{((((((.((..(((((...((({(({{(((({(,,,,...,,|{{{|..(((((((..(((({,((,.{{{((||((((,.,{{,.,,{({{,(({{{,.((((({.(({,.((,{(((((((,{{(((((({((({...,.{{{({,,.......|)))}.|...|}}}})))))|,,.,((((,(((.((((....)))),))).))))..|||||||||,||||.(({...{{.{(((((((((.,..(((..{((({{{.{,{{....)).,.)).))))))))..}.))))))))}.},)),|,|||,||||{||||||.{(((,,,|}}}............,,,|||||||||||....,,||||.,,)}))...,,,.,,||||.......,,)))},,..}))}))||.|||,,.})))})|||,,,|}||||}})},,||,|||)))....))))||).}}}}}|})))).|.......,,}}.(((((...)))))........,})))).....)))))..)).)))))}),,.....((((........)))).}})}..}))))...,,}),}))))),},,}|,|}|,.})).}}}.|||||||||}.{{||.{{{{.,,|}}}.}}}}{{.,,,{{{{((((({....,,,.(((((((........)))}..))).....|..,{|{{,.}|..,||.,,}}}..,}||||,,.{|{||....,..)}})},{|||||{,,,||,...{{{{{||,,,,,...})}})}))),,,,}}}},.)))))))|{|{|{,,,,,,.,{{|||.,|||,,,}}||||||||((((,((({((({{((((.((({{(...{(((,((((((({,{(((,((({...((((({.{(((........}}))..}))))),}|||{{(((((((....|}}}|,,((({{.,(((,,,...{{{....,|}}|.|,}))}|,,,,}},}|||.|,,}}}|{{{(((((....})))).}}}}||,|},}}})}}})))|}))}}.)))},)),)}||||.,||||.||.||||||}....|||{|}}}}})),,,,,,...,,,..,{{{.,...,,,}))}..|(((,({,...,,,,.}}.}}}|,}}|,|||}|},,,.(((..{(((.(((.{{,,...,}}},}}}}.})}||,,|||,{.,,.......|||||,||||||}},{{..{{{||,...{{{{{||{(({{{(((((((((...((((.((((((((((.(((.,.((((.((((,,......,||||||{........{{{....}}}(((((((....,,,((((((((....))))))))..,,,..)))))))..||||||}}|{{,..,....,...,,,,..)))).)))}...))))))))))))))))))))))))))((((.((((((((....((((((..{{.(((..(((.......)))....))).}}..))))))...))))).))))))).....{,,,,(((.{({{{{..,,})))))}.......}}}},.||||||}|||||}}|||,,,||||||||}}}|,...}}}}},..}))}..,,,.....,}}})),...||||||{,,}}}}},.,{{|||,,,.,|||}}.,|||}}||,}}.}}.........}}}}}|.|)))}))))),,..})}},},}})}))}))}}}}},,....,}),))}))}))....||||,||||||,..|||||,,.,,,..,,{(((((((......})))))}}...,((((,((((...,..,,}}},.}}}}}|{{|,.,...,,..,,,|((({{((((((((({({{{{{{.((((({.{{{.....,....,,,....,,,,.((((({.......}))))}{{||,,,.{{{{(((({...((((({...})))))((((((((...)))))))}{{{,,,{{,.,{{(((((,,.(((((,.((((({.,{{(({{(({(({.,(((,({({,.,....(((((....))}||,,{,,..,....(({(..,,,||}|,,{,{{,,,||.||||},{{..{{{{{{....)))})}||{{,|||||||{((((((.((((..........)))).))))))..{{{......(((((((...(((((((((....)))))))))....))))))).......|||.....,{{{{{{,..,{{.....,,||||||{{{{(((,{,,,,,,.,.}}}.{((((({.........|||,|,.,,,,........(((((((..((((((...{(((((({((((((.((((.{,,,(((((((({..,(((,,,,{(((((,(((((.(((((......))))).}))))}))))}..{{{((((.,,,....}}}}}}|.......|||,|||{{,||,|||}|{{{{{{,.....,,..{{|,,..)},||||......................,,,)))},...{{{((((((....))))))),,}}}})}|)}|,}|,.......))})))))}{((((,,......)))})|||||,{|||||{{|||||}|}}||.|||....},}.,.....,,((({((,,,.....}}..}},......}}}),)},})))))}},})))))))))},,,,....((((((((((.({(({({,{{.,((((((((...............)))))))),}}))).)}),..)))))).)))).....,,,..((((((......))))))......,..)))))))..)))))).))))))){((((.((((((.....))))))..))))),,.{{...,||,.((((((..(((...)))..))))))...))))}))}})|||}}.||||{{{{{.........,,.,,,,,,.|}}|{{((((((((((((({,..((((......,,({{(((......,,{,..........,}|,,....,}}..}}}})}..,,,,.{{{{{{{{{{{{||||||{(({,,((((((....}))))))))))}|||||.....{{{{{{{(,..,{((...,,{|||||||||||,.|||}}}|||||,....||}}}}}}...}}},..,.......((((.,,{{,..,,(({......))),.{,{,|}}}),,},..)))).{(((((((((....)))))))))}{{{|||||,}||{,{|||{|||||.,,,}|}}}||,|||}}},...,,,}}|,}||||,},.,|||||...,}|}|||||,,}}}}))))))..,}}}}|||},,,}}}}|,}}||,|,}|||||||,,},.,.|{{{|,..{{{{.|.{{|..|{|{{{|,.......)))))))..}}),},)))),}).,}}}|(((((((...........}))))))|(((,,,.,||{{,,,,})}),))))}.|||||,,}}|||}(((((.((((........)))))))))......{{{{{{{{{..,|||||,,||{{|.|||,.,||||||{{|||,,.|,|}|,,,.,,,,,,,,...{{{..,,,,,,,.))}...,..,....}}|..,{{|,..,,|..........,,,|||.||},....,||||||||||(((((..|{,,.)).,)))))).,....}}})))))}......,|},})}.}}}}}}.,,,,.,,,,,,,}}}}}},((((((....))))))..,,........}}|,{{...)))..}}.)))))))))))...},,...)))))))))}}.((((((.....)))))).,,)))}.}}}}}.(((((((.,.........)))))))..|{{{{||||,,.|{||{{{{,,||{(({,,.,{{{{,|..},|||...,}}}}},}..},}.,,||||,.,,,,,,,,,..,{{{.......,)}}{(((((.....}))))}{{({{..,,..((((((((((....)))))))))).,.}}))}........})))}}))},..}}|}}}}|.}},,,||||||}}}}}))))))))}}}}}}...........{((((((((((((((((((((((((((((((.((.,.(((.(((.(((((((((((((((((((((((.(((...(((((((.(((..(((((((.((((((((((.(..((((((((((.((((((((((.(((.((((((.((((((..{..((((((((.((..(((((((((((.,.((((((.(((((((({..(((((.((((.((..(((((.(((((((((.((((((..(((((((((.((((((((.(((((((.((((((((((((((((({{((((((((((.(((((.(((((....((({,.(((((((,....,.))))))).|,|||,..,{{..,,,...|||,,|||||||.........{{{{.(((((((((.....{{{{.,{(((({{....((((((((.(((((....((((((.{{,.{(((((((.(((({,..........{({{{......,.(((({{(((.,,....,,...............{{........)){((((........))))}|((({........}}}}},,||,.....{{({{{{,,..,||,..........,,,}}||||||||||,.....,}.))))))))),,{((,.{{(({((((.,..{||{|.,,}}))),,.....(((((.(((((.,,....,}.))))).)))))...{{{({.{{,.....,,.}},}}}}}.),}}))))))).,))))))))..))))))))..(((({....}})))..........,},.))))))))))).))))))))..}},))))}......((((.......))))....}}},...)))))))))...))))))))....))))).))))).)))))))))))))))))))))))))))).))))))).)))))))).)))))),.)))..)))))).))))))))).)))))..)).)))).)))))..}))))))))..))))))..)))))))))))..)).))))))))..}..)))))).)))))).))).)))))))))).))))))))))..).)))))))))))))))))..))).)))))))...))).))))))))))))))))))))))).))).)))...)).))))))))))))))))))))))))))))))}}}))}})))))))}}}}}}}}},,,}},)))}))}|.}|,.,}}})))}}|}}}|,||,,,,,.}}}}}}.})))))))))))}.)))))))}..}}}|||||..{{|||,,|,,..}}}}}.,,.,,,.|||||||,..,,,,)))))))))...)))).........(((((({...}))))))..))),)))))).})))))........,,,,,...))}}})))))}..}))}}}......},,.,.}},))))))))......)))))),,.............)))..,}})},)))))))))),)))))))))).......)))))))))).......

Transcripts

ID Sequence Length GC content
CUUCCCCCAAUCCCCUCAGGCUCGGCUGCGCCCGGGGCCGCGGGCCGGU… 5062 nt 0.4749
CUUCCCCCAAUCCCCUCAGGCUCGGCUGCGCCCGGGGCCGCGGGCCGGU… 9423 nt 0.4048
CUUCCCCCAAUCCCCUCAGGCUCGGCUGCGCCCGGGGCCGCGGGCCGGU… 6459 nt 0.4107
Showing 11 to 13 of 13 entries
Summary

This gene encodes a protein belonging to the RAF family of serine/threonine protein kinases. This protein plays a role in regulating the MAP kinase/ERK signaling pathway, which affects cell division, differentiation, and secretion. Mutations in this gene, most commonly the V600E mutation, are the most frequently identified cancer-causing mutations in melanoma, and have been identified in various other cancers as well, including non-Hodgkin lymphoma, colorectal cancer, thyroid carcinoma, non-small cell lung carcinoma, hairy cell leukemia and adenocarcinoma of lung. Mutations in this gene are also associated with cardiofaciocutaneous, Noonan, and Costello syndromes, which exhibit overlapping phenotypes. A pseudogene of this gene has been identified on the X chromosome. [provided by RefSeq, Aug 2017] CIViC Summary for BRAF Gene BRAF mutations are found to be recurrent in many cancer types. Of these, the mutation of valine 600 to glutamic acid (V600E) is the most prevalent. V600E has been determined to be an activating mutation, and cells that harbor it, along with other V600 mutations are sensitive to the BRAF inhibitor dabrafenib. It is also common to use MEK inhibition as a substitute for BRAF inhibitors, and the MEK inhibitor trametinib has seen some success in BRAF mutant melanomas. BRAF mutations have also been correlated with poor prognosis in many cancer types, although there is at least one study that questions this conclusion in papillary thyroid cancer. Oncogenic BRAF mutations are divided into three categories that determine their sensitivity to inhibitors. Class 1 BRAF mutations (V600) are RAS-independent, signal as monomers and are sensitive to current RAF monomer inhibitors. Class 2 BRAF mutations (K601E, K601N, K601T, L597Q, L597V, G469A, G469V, G469R, G464V, G464E, and fusions) are RAS-independent, signaling as constitutive dimers and are resistant to vemurafenib. Such mutants may be sensitive to novel RAF dimer inhibitors or MEK inhibitors. Class 3 BRAF mutations (D287H, V459L, G466V, G466E, G466A, S467L, G469E, N581S, N581I, D594N, D594G, D594A, D594H, F595L, G596D, and G596R) with low or absent kinase activity are RAS-dependent and they activate ERK by increasing their binding to activated RAS and wild-type CRAF. Class 3 BRAF mutations coexist with mutations in RAS or NF1 in melanoma may be treated with MEK inhibitors. In epithelial tumors such as CRC or NSCLC may be effectively treated with combinations that include inhibitors of receptor tyrosine kinase.

Forensic Context

No relevant information is available at the moment.