Basic Information

Symbol
XRCC1
RNA class
mRNA
Alias
X-Ray Repair Cross Complementing 1 DNA Repair Protein XRCC1 X-Ray Repair Complementing Defective Repair In Chinese Hamster Cells 1 X-Ray Repair Cross-Complementing Protein 1 RCC SCAR26
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_006297.3
Sequence length
2052.0 nt
GC content
0.5853

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-757.40 kcal/mol
Thermodynamic ensemble
Free energy: -791.96 kcal/mol
Frequency: 0.0000
Diversity: 529.41
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((..(((((((((..............((((((((.(((....(((...)))...(((..(((((((.(((((......))))).))))))).)))(((((.(((..((.......))..))))))))....(((((((..((.................(((((((..(((......))).....((((((....)))))).(((((((((((..((.............((((..((...((((((((((((((.(((((....(((.((((((((.(((...(((.((((((((.(((((((((((..((((.((((.(((..(((((((...........((((.(((((.(.(((((.....))))).................((.(((..(((((((.(((((((((((((.((((.((......))))))...)))))))).....))))))))...)))).)))))..((((....((((((.((((..((((((..((((....))))......)))))).)))).))))))....))))).))))).))))))))))).(((.((...(((...(((((.((..(((((.((((((.((..(((...)))....)).)))))).)))))..))((((.........))))....)))))...)))...))))).(((..((((.........))))...))))))))))))))..)).))))))))).))))))))((((.((((...(((.....)))....))))..))))((((((...))).))).....((((.......))))........)))..))))))))..))).)))....)))))..)))))).))))))))....))...))))))..)))))))).))).))).))))..(((...(((.((((((.........)))))).))).)))...))..))))))).(((.....)))...........(((((((.((((..(..(((((((((...)))).((((.((((..((((.(((.((.((((((((.((((.....(((((..((.(((.(((..((((.....((((((((....(((..(((((((..((...((........))..))...)))).)))..)))......))))))))....(((((((...)))))))..))))..))).)))))..))))))))).)))))((((((((((.(((...((.(.(((((((.((((((....))).))).)))).))).).)).)))(((((.(((......)))))))).))))))))))..(((..(((((......))))))))...))).))..)))))))..)))).)))).))))).)..))))..))))))).(((((((((((((.....((((..............(((((..(((((.((.(........).)))))))..))))).............)))).....)))))......))))))))...)))))))))))))))))((((.(((((.................))))))))))))..))))(((((((((.....)))((.(((.(((.((((((((((....((((((((.((((..((.((((.(((((((.(......(((((.(((((((((........(((((((.....(((((((.......))))))).)))))))((((.....((((......))))...)))).((........))))))))))).)))))....((((....((((((..((((((.......))))))....))))))..))))).))))))))))).)).......)))).)))...)))))))))))((.(((((......((((...(((((((.........))).)))).))))))))).)))))).)))))).)).....((.((((.....)))).)).............................((((.(((((.....))))).)))))))))).
Thermodynamic Ensemble Prediction
...((((,,(((({((((..............((((((({((((((({(((,..|||...{{{,.{((((((.(((((......))))).))))))}.|||((((,.{{|..||,,,....}}..}}}|}}}}....{{{{{{{..{|..,...,,..{{,....{||{|||..|||..,,,.))}||||.{{{{{||||{{{{|{,.(((((((((((..((...........,.{{{{.,((.,.((((((((((((((.(((((....(((.((((((((.(((...(((.((((((((.(((((((((((..((((.((((((({..((((({(.,,,,,,,...{(((.{((((.,.(((((,...,)))))...........((,{{{((.((((((((((.,.....|.|}}|}}}}}}||,}|,,.,..)))||{{{{{,(({{{,....,{{,|{{,{...||,..,,,}},|((,,....||||{||{{{,|,|{{{{{..((({....})))...,.,))))}}.}}})})}}}))))}.)))))}))))),)))}))))))}.(({,((,..{{{...(((((.((..(((((.((((((.((..(((...)))....)).)))))).)))))..))((((,.....|,.,)))....))))),,,))),.,)}))}}||}}}|((({....})))|||....,...)))}}}))))..))}})))))))).))))))))((((.((((...(((.....)))....))))..))))((((((...)))},)).....{(((.......)))}........)}}..)))))))),.,)).)))....)))))..)))))).))))))))....))...}}}}))..)))))))).))).....))))}}(((...(((.((((((.........)))))).))).)))...,,..}|||}},.(((.....)}}..,.{.....}}.|})))||||}.,((((((((((((...||}}.((((.((((..((((.(((.({.((((((((.((((.....(((((..((.(((.(((..(((({,.,.((((((((....(((..(((((((.{((...{({.....,.}}..|},,.)))).)))..)))......))))))))....(((((((...))))))),.))))..))).)))))..))))))))}.)))),((((((((((.{((...((.(.(((((((.((((((....))).))).))))},)).).)).))}(((({{(((......)))))))).))))))))))..{{(..(((((......)))))})).}}))).,}..)))))))..)))).)))).,{({|,,,,))}}.||||||||.(((((((((((((.....((((..............(((((..(((((,({.,.........,)})))))..)))))...,|,.......)))).....)))))......)))))))).....,}}}})))))))}))((((.(((((....,............)))))))))))),,))))({{{(((((.....)))||.{{{.(((,(({{(({(((,..,{({{{(((.((((..{{.((((.(((((((.{.,,{,.(((((.(((((((((........{((((((...,.{((((({.......))))))),))))))}((((..,,.((((......))))...)))).{{........}}))))))))).)))))....,{{{....((((((.,((({((.......}}))}).,,.)))))),.)},,}.))))))))))).}),....,,)))).))),,.}}})))))))){{.{{{{|.....|{(((,..{{{{{{{..,..,...)))}}))}.)))))))}),)))))),)))}}}.}).,...((.((((.......}}.},,,...........................((({.(((((.....))))).)))))))))).

Transcripts

ID Sequence Length GC content
ACUCUCCCUGCCCCUCGGACCCCAUACUCUACCUCAUCCUUCUGGCCAG… 2052 nt 0.5853
Summary

The protein encoded by this gene is involved in the efficient repair of DNA single-strand breaks formed by exposure to ionizing radiation and alkylating agents. This protein interacts with DNA ligase III, polymerase beta and poly (ADP-ribose) polymerase to participate in the base excision repair pathway. It may play a role in DNA processing during meiogenesis and recombination in germ cells. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. [provided by RefSeq, Jul 2008] CIViC Summary for XRCC1 Gene

Forensic Context

A study in rats demonstrated that blast-induced mild traumatic brain injury triggers a complex vascular repair and inflammatory response, with mRNA expression of the XRCC1 being upregulated at 2 and 24 hours after a 14–15 psi exposure, indicating its involvement in the DNA base excision repair pathway activated by more severe blast injury [Balaban et al. DOI:10.1016/j.jneumeth.2016.02.001].