| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUCUCCCUGCCCCUCGGACCCCAUACUCUACCUCAUCCUUCUGGCCAG… | 2052 nt | 0.5853 |
The protein encoded by this gene is involved in the efficient repair of DNA single-strand breaks formed by exposure to ionizing radiation and alkylating agents. This protein interacts with DNA ligase III, polymerase beta and poly (ADP-ribose) polymerase to participate in the base excision repair pathway. It may play a role in DNA processing during meiogenesis and recombination in germ cells. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. [provided by RefSeq, Jul 2008] CIViC Summary for XRCC1 Gene
A study in rats demonstrated that blast-induced mild traumatic brain injury triggers a complex vascular repair and inflammatory response, with mRNA expression of the XRCC1 being upregulated at 2 and 24 hours after a 14–15 psi exposure, indicating its involvement in the DNA base excision repair pathway activated by more severe blast injury [Balaban et al. DOI:10.1016/j.jneumeth.2016.02.001].