| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCUAUCUGCCGCUUGUCCACCGGAAGCGAGUUGCGACACGGCAGGUUCC… | 3379 nt | 0.4247 |
The protein encoded by this gene is the 80-kilodalton subunit of the Ku heterodimer protein which is also known as ATP-dependant DNA helicase II or DNA repair protein XRCC5. Ku is the DNA-binding component of the DNA-dependent protein kinase, and it functions together with the DNA ligase IV-XRCC4 complex in the repair of DNA double-strand break by non-homologous end joining and the completion of V(D)J recombination events. This gene functionally complements Chinese hamster xrs-6, a mutant defective in DNA double-strand break repair and in ability to undergo V(D)J recombination. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that ionizing radiation exposure (6.5 Gy) induced differential expression of numerous genes in bone marrow cells, including a 0.28-fold downregulation of the XRCC5 mRNA [Dai et al. DOI:10.1080/09553000600857389].