Basic Information

Symbol
XRCC5
RNA class
mRNA
Alias
X-Ray Repair Cross Complementing 5 Ku86 KARP-1 KU80 KUB2 X-Ray Repair Complementing Defective Repair In Chinese Hamster Cells 5 (Double-Strand-Break Rejoining) ATP-Dependent DNA Helicase II 80 KDa Subunit X-Ray Repair Cross-Complementing Protein 5 ATP-Dependent DNA Helicase 2 Subunit 2 CTC Box-Binding Factor 85 KDa Subunit Lupus Ku Autoantigen Protein P86 86 KDa Subunit Of Ku Antigen Thyroid-Lupus Autoantigen DNA Repair Protein XRCC5 Ku Autoantigen, 80kDa Nuclear Factor IV CTC85 CTCBF TLAA X-Ray Repair Complementing Defective Repair In Chinese Hamster Cells 5 (Double-Strand-Break Rejoining; Ku Autoantigen, 80kD) Ku86 Autoantigen Related Protein 1 EC 3.6.4.- KARP1 G22P2 NFIV Ku80
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_021141.4
Sequence length
3379.0 nt
GC content
0.4247

Transcripts

ID Sequence Length GC content
GCUAUCUGCCGCUUGUCCACCGGAAGCGAGUUGCGACACGGCAGGUUCC… 3379 nt 0.4247
Summary

The protein encoded by this gene is the 80-kilodalton subunit of the Ku heterodimer protein which is also known as ATP-dependant DNA helicase II or DNA repair protein XRCC5. Ku is the DNA-binding component of the DNA-dependent protein kinase, and it functions together with the DNA ligase IV-XRCC4 complex in the repair of DNA double-strand break by non-homologous end joining and the completion of V(D)J recombination events. This gene functionally complements Chinese hamster xrs-6, a mutant defective in DNA double-strand break repair and in ability to undergo V(D)J recombination. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that ionizing radiation exposure (6.5 Gy) induced differential expression of numerous genes in bone marrow cells, including a 0.28-fold downregulation of the XRCC5 mRNA [Dai et al. DOI:10.1080/09553000600857389].