| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUCUCGCUAGUUCGAUCGGUAGCGGGAGCGGAGAGCGGACCCCAGAGA… | 2979 nt | 0.4750 |
This gene encodes a highly conserved cold shock domain protein that has broad nucleic acid binding properties. The encoded protein functions as both a DNA and RNA binding protein and has been implicated in numerous cellular processes including regulation of transcription and translation, pre-mRNA splicing, DNA reparation and mRNA packaging. This protein is also a component of messenger ribonucleoprotein (mRNP) complexes and may have a role in microRNA processing. This protein can be secreted through non-classical pathways and functions as an extracellular mitogen. Aberrant expression of the gene is associated with cancer proliferation in numerous tissues. This gene may be a prognostic marker for poor outcome and drug resistance in certain cancers. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on multiple chromosomes. [provided by RefSeq, Sep 2015]
A study in domestic pigs demonstrated that multiple trauma with traumatic hemorrhage significantly altered hypoxia-related protein concentrations in bone, where YB-1 concentrations in bone marrow at the fracture site were significantly lower in the trauma group compared to sham animals [Bläsius et al. DOI:10.1186/s40001-023-00996-w].