Basic Information

Symbol
YBX1
RNA class
mRNA
Alias
Y-Box Binding Protein 1 YB-1 DBPB YB1 MDR-NF1 NSEP-1 CSDA2 NSEP1 BP-8 CSDB CCAAT-Binding Transcription Factor I Subunit A Nuclease-Sensitive Element-Binding Protein 1 Enhancer Factor I Subunit A Y-Box Transcription Factor Y-Box-Binding Protein 1 DNA-Binding Protein B CBF-A EFI-A Major Histocompatibility Complex, Class II, Y Box-Binding Protein I Nuclease Sensitive Element Binding Protein 1
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_004559.5
Sequence length
2979.0 nt
GC content
0.4750

Transcripts

ID Sequence Length GC content
AUUCUCGCUAGUUCGAUCGGUAGCGGGAGCGGAGAGCGGACCCCAGAGA… 2979 nt 0.4750
Summary

This gene encodes a highly conserved cold shock domain protein that has broad nucleic acid binding properties. The encoded protein functions as both a DNA and RNA binding protein and has been implicated in numerous cellular processes including regulation of transcription and translation, pre-mRNA splicing, DNA reparation and mRNA packaging. This protein is also a component of messenger ribonucleoprotein (mRNP) complexes and may have a role in microRNA processing. This protein can be secreted through non-classical pathways and functions as an extracellular mitogen. Aberrant expression of the gene is associated with cancer proliferation in numerous tissues. This gene may be a prognostic marker for poor outcome and drug resistance in certain cancers. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on multiple chromosomes. [provided by RefSeq, Sep 2015]

Forensic Context

A study in domestic pigs demonstrated that multiple trauma with traumatic hemorrhage significantly altered hypoxia-related protein concentrations in bone, where YB-1 concentrations in bone marrow at the fracture site were significantly lower in the trauma group compared to sham animals [Bläsius et al. DOI:10.1186/s40001-023-00996-w].