| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUCGCCGCCGCCGCCGCCAUUGGAGUCGACGCCUCCUCAGUGCGUCCGC… | 3198 nt | 0.5091 |
Enables N6-methyladenosine-containing RNA reader activity and ribosome binding activity. Involved in mRNA destabilization; positive regulation of translational initiation; and stress granule assembly. Located in P-body and cytoplasmic stress granule. Implicated in colorectal cancer. [provided by Alliance of Genome Resources, Jul 2025]
A study in mice and human tissues demonstrated that the YTHDF1 binds to m6A-modified COL3A1, COL1A1, and ELN mRNAs to stabilize them, promoting pathological extracellular matrix deposition in hypertrophic scarring [Zhang et al. DOI:10.7150/ijbs.114988].