| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAGCGUCGCCGAGUCGGAGCCGGAGCCUGAGCCGCGCGCUGUGUCUCC… | 2719 nt | 0.4601 | |
| CUUUCCAGGUGUUAGUCGAAACCUCGUGGUGCGACCCUGGUCGUCCCAA… | 2823 nt | 0.4651 | |
| AGAGCGUCGCCGAGUCGGAGCCGGAGCCUGAGCCGCGCGCUGUGUCUCC… | 2744 nt | 0.4595 |
This gene encodes a member of the YTH (YT521-B homology) superfamily containing YTH domain. The YTH domain is typical for the eukaryotes and is particularly abundant in plants. The YTH domain is usually located in the middle of the protein sequence and may function in binding to RNA. In addition to a YTH domain, this protein has a proline rich region which may be involved in signal transduction. An Alu-rich domain has been identified in one of the introns of this gene, which is thought to be associated with human longevity. In addition, reciprocal translocations between this gene and the Runx1 (AML1) gene on chromosome 21 has been observed in patients with acute myeloid leukemia. This gene was initially mapped to chromosome 14, which was later turned out to be a pseudogene. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Oct 2012]
A study in mice demonstrated that the YTHDF2 was notably upregulated at the mRNA level in myocardial tissue following ischemia/reperfusion injury [Li et al. DOI:10.21037/atm-22-1289]. In the context of skin wound healing, the YTHDF2 promotes keratinocyte migration and wound closure by stabilizing PELI2 expression in concert with ALKBH5, and its expression is downregulated in high-risk keloid groups [Zhang et al. DOI:10.7150/ijbs.114988]. A study in mice demonstrated that following spinal cord injury, global RNA m6A levels were significantly decreased, with 11,059 mRNAs and 1,556 lncRNAs showing hypo-methylation and 194 mRNAs and 46 lncRNAs showing hyper-methylation [Ni et al. DOI:10.3389/fnins.2022.904573].