| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGAUUGAGGCGCCGCCAUUUUUGCUGCCCGGACGCGGAGCGAGAGGCUG… | 2052 nt | 0.4313 |
This gene product belongs to the 14-3-3 family of proteins which mediate signal transduction by binding to phosphoserine-containing proteins. This highly conserved protein family is found in both plants and mammals, and this protein is 100% identical to the mouse ortholog. It interacts with CDC25 phosphatases, RAF1 and IRS1 proteins, suggesting its role in diverse biochemical activities related to signal transduction, such as cell division and regulation of insulin sensitivity. It has also been implicated in the pathogenesis of small cell lung cancer. Two transcript variants, one protein-coding and the other non-protein-coding, have been found for this gene. [provided by RefSeq, Aug 2008]
A study in mice demonstrated that the YWHAE was differentially expressed in blood leukocytes following injury, showing downregulation after burn injury but upregulation after lipopolysaccharide infusion and trauma/hemorrhage [Brownstein et al. DOI:10.1152/physiolgenomics.00213.2005]. In rats, a separate investigation of hypothermic hypothalami identified the YWHAE as a transcript more abundant in control animals compared to hypothermia models, a finding validated by quantitative PCR [Takamiya et al. DOI:10.1016/J.Jflm.2012.04.017].