Basic Information

Symbol
YWHAE
RNA class
mRNA
Alias
Tyrosine 3-Monooxygenase/Tryptophan 5-Monooxygenase Activation Protein Epsilon Tyrosine 3-Monooxygenase/Tryptophan 5-Monooxygenase Activation Protein, Epsilon Polypeptide 14-3-3 Protein Epsilon 14-3-3 Epsilon FLJ45465 14-3-3E Tyrosine 3/Tryptophan 5 -Monooxygenase Activation Protein, Epsilon Polypeptide Mitochondrial Import Stimulation Factor L Subunit Protein Kinase C Inhibitor Protein-1 Epididymis Luminal Protein 2 KCIP-1 HEL2 MDCR MDS
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_006761.5
Sequence length
2052.0 nt
GC content
0.4313

Transcripts

ID Sequence Length GC content
GGAUUGAGGCGCCGCCAUUUUUGCUGCCCGGACGCGGAGCGAGAGGCUG… 2052 nt 0.4313
Summary

This gene product belongs to the 14-3-3 family of proteins which mediate signal transduction by binding to phosphoserine-containing proteins. This highly conserved protein family is found in both plants and mammals, and this protein is 100% identical to the mouse ortholog. It interacts with CDC25 phosphatases, RAF1 and IRS1 proteins, suggesting its role in diverse biochemical activities related to signal transduction, such as cell division and regulation of insulin sensitivity. It has also been implicated in the pathogenesis of small cell lung cancer. Two transcript variants, one protein-coding and the other non-protein-coding, have been found for this gene. [provided by RefSeq, Aug 2008]

Forensic Context

A study in mice demonstrated that the YWHAE was differentially expressed in blood leukocytes following injury, showing downregulation after burn injury but upregulation after lipopolysaccharide infusion and trauma/hemorrhage [Brownstein et al. DOI:10.1152/physiolgenomics.00213.2005]. In rats, a separate investigation of hypothermic hypothalami identified the YWHAE as a transcript more abundant in control animals compared to hypothermia models, a finding validated by quantitative PCR [Takamiya et al. DOI:10.1016/J.Jflm.2012.04.017].