Basic Information

Symbol
YWHAQ
RNA class
mRNA
Alias
Tyrosine 3-Monooxygenase/Tryptophan 5-Monooxygenase Activation Protein Theta 14-3-3 HS1 Tyrosine 3-Monooxygenase/Tryptophan 5-Monooxygenase Activation Protein, Theta Polypeptide 14-3-3 Protein T-Cell 14-3-3 Protein Theta 14-3-3 Protein Tau Protein, Theta 14-3-3 Theta Protein Tau Protein HS1 1C5
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_006826.4
Sequence length
2196.0 nt
GC content
0.4294

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-591.87 kcal/mol
Thermodynamic ensemble
Free energy: -641.44 kcal/mol
Frequency: 0.0000
Diversity: 580.61
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((.....))........(((((..(((.((((((..((((((((((((.(((.....))).)(((((((.....((((.(((((....(((((.((((((.(((.....(((..(((((((((((..((....(((.((((..((......))..))))...)))...)).))))).)..))))).)))...))).))...((.(((.(((......)))))).)))))))))))))))).)))).....)))))))(((...)))))))))))))).....).))))))))....)))))..((((((.(((((((((.(((((.((.....)))).)))..))).))))))....((((((((.(((((..(((((((.(((((((.(((.(((((((((.......((((...((((....))))))))....))))).............((....)).......(((((..((..((((((((...(((((.((((((((.((((((.(..(((.(((....))).)))..).)))))).)))..........((((((((.....((((((((((......))))((((.(((((((..(((((((((.(((((((.((.............))))).))))))))....)))))....)))).))).)))).........(((((((((..(((((((((((.......))))...((((((((....(((((..(((.......((.((((....)))).))))).))))).))))))))....((((((...)).))))((((....))))..........))))))).............((((..((((((((((.((((....((((((((((((.......((((((.((....((((((...............................)).))))....)).)))))))))).......)))))))).......)))).))))))))))...)))))))))))))..........)))))).....))))))))...(((.....))).((((((...))))))...............)))))))))).....((((((((...........))))))))))))))))....))...)))))......(((((((.(((((((((........))))).)))).).))))))((((((.((((((..(((.((....(((..........)))....)))))..)))))).)))).)).....))))))).))).)))).))..))))))))))..))))))))(((((((.(((((((.((((((.......)))))).)((((((((.(((((((((((.(((((((((.(((((((((..(((.((((((....((((.((((.(((...((((((..(((((.(((((((((...((((((((((((((..........)))))))....((....))....)))))))...((((((.........................((((....))))(((((((..((((........)))).((((((.((((((...(((((((.....(((...)))))))))).........)))))).))))))......)))))))))))))...........))))))))).))((((((((....)))).)))).))).((((......)))).))))))..))).).))).))))....)))))).)))..))))))..)))(((((....))).))..............((((((((....((((((..(((((.(((((((......(((....)))..)))))))...((((((.....))))))......)))))...))))))((.(((((.(((((..........((((((...((.(((..(((.........)))..))).))...))))))..((((.((((((((((....)).))))))))..)))))))))))))).))(((((..((((((....)))))))))))........)))))))).......))))))))).))))...))))))).)))........))))).(((((((.....))))))))))))).))...))))).....)))))).......((((.....))))..
Thermodynamic Ensemble Prediction
.(((.((({.(((((((({,(,((((((((.((((((..(((((((((({{{{{{.,,.,,}}.,(((((((.....((((.(((((,,,,{{{((.((((.,.({(,,...{((..((((({(((((..((....(((.((((..((......))..))))...)))...)).))))).}..))))).)}),..,},,}}...((.({,{(((......))))}).}))))))))))))))).)))).....))))))){{....}))))))))))))).....).,)))))))({(((((...))))).)}{((((((((.(((((.((.....)))),,))..))).)))))}.{..((((((((((.((...(((((((((.((.((.(((((((((..(((..(((({......((((....))))((((...((((.((...,,,...,}}....}).))))...))))|.{{(,(((((.((((...{((({,.((((((((((.,{{,.{{({,,(((((({.,{{((({(,((({{{..((((........))))......,(((...)))|,||}}},..}.}}|,||......}}}}}}...{{{{.{{{{{{{,||,.,,,.....,..))))}.}}}}|}}}..{{{{{{{({,,,{{{..,|,|}||{|{,........,,}}},,,(((((((((((,,,....|}||...((((((((....(((((..(((.......((.,{{,....)))).}}))).))))).)))))))).,..||||,{,,,.,.,,,}|||,...,||}}...,))).,.)))))))..},},}}})})},,})))}})))}}}}}........{{((.....)))))))))))))),}}..}}}}))))))))).,,.,..}))))..}))...))))))))).{{||||||,,,{({..{{,..,,,|}}.}}},,),))}}))..)),)}.)))))))))...}})))))))))),,|,.....,)})),)))))))))).}))).))).{((((((..(((((((...((((,({.((((((((((({.{({,,{{{{{{{.....((((((((...........)))))))),{(((({,......,,.{,{,||.{,,.(((((((.(((((((((,.....,.))))).)))).).)))))){{{{{{.{{{{{{.((((,(...,,{{{........,,||}....}}}}...)))))),))}),))},,.{(((({.........)))))..}}}}},.,({{{(...(((((((((.,{{{{{{((.,(((({.,,....})))),..)}}).}}}})}}..,.)))))))))..})))).{{{{{{,...||||||,,.....})}}}))))}|||{{{{...}))))),((.(((((((({,,,(((((({{((((((..........}))))}}....||.,,.,,....))))))}...((((((.........................((((....)))){((((((..((((........)))).((((((.((((({,{{((((((({..,{{,,..,),)))))))}......,)})))))).))))))......))))))}))))))...........))))))))).)).||{.....,}})))))))))))).,,)))).....)))))))..).)))))|(((((.(((((((({((({...{({{{{(((((.(((.((({.,,.|||{{,,{,,...,,..{{.((((((((.,..((((((.,(((({.{((((((....,.(({.,,.}}}..))})))),..{({{{{.....))))))......})))).,.))))))((.((((,{(((({....,.....((((((.,,((.(((..(((.........)))..))).)).,,))))))..|||{.((((((((((....)),})))))))..}}},}))))))))).})(((((..((((((....)))))))))))........))))))))..,,..{{(,{{.{{||,..}))).)).))}..})),))).)))))..{(((((((.....)))))))).}))},))))}.))),,)))).))))),......,{{{.....}))}..

Transcripts

ID Sequence Length GC content
AAAGCCAAAAGCAGAUCAAAGUGGUGGGACUCGCGUCGCGGCCGCGGAG… 2196 nt 0.4294
Summary

This gene product belongs to the 14-3-3 family of proteins which mediate signal transduction by binding to phosphoserine-containing proteins. This highly conserved protein family is found in both plants and mammals, and this protein is 99% identical to the mouse and rat orthologs. This gene is upregulated in patients with amyotrophic lateral sclerosis. It contains in its 5' UTR a 6 bp tandem repeat sequence which is polymorphic, however, there is no correlation between the repeat number and the disease. [provided by RefSeq, Jul 2008]

Forensic Context

A study in rats demonstrated that the YWHAQ was differentially expressed in the hypothalamus during hypothermia, with SuperSAGE analysis showing 85 tags in control versus 47 tags in hypothermic samples, a finding validated by quantitative PCR as being significantly higher in control animals [Takamiya et al. DOI:10.1016/J.Jflm.2012.04.017]. In mice subjected to trauma/hemorrhage, burn, or LPS-induced inflammation, microarray analysis of blood leukocytes revealed the YWHAQ was downregulated in burn and LPS models but upregulated in the trauma/hemorrhage model [Brownstein et al. DOI:10.1152/physiolgenomics.00213.2005].