| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAAGCCAAAAGCAGAUCAAAGUGGUGGGACUCGCGUCGCGGCCGCGGAG… | 2196 nt | 0.4294 |
This gene product belongs to the 14-3-3 family of proteins which mediate signal transduction by binding to phosphoserine-containing proteins. This highly conserved protein family is found in both plants and mammals, and this protein is 99% identical to the mouse and rat orthologs. This gene is upregulated in patients with amyotrophic lateral sclerosis. It contains in its 5' UTR a 6 bp tandem repeat sequence which is polymorphic, however, there is no correlation between the repeat number and the disease. [provided by RefSeq, Jul 2008]
A study in rats demonstrated that the YWHAQ was differentially expressed in the hypothalamus during hypothermia, with SuperSAGE analysis showing 85 tags in control versus 47 tags in hypothermic samples, a finding validated by quantitative PCR as being significantly higher in control animals [Takamiya et al. DOI:10.1016/J.Jflm.2012.04.017]. In mice subjected to trauma/hemorrhage, burn, or LPS-induced inflammation, microarray analysis of blood leukocytes revealed the YWHAQ was downregulated in burn and LPS models but upregulated in the trauma/hemorrhage model [Brownstein et al. DOI:10.1152/physiolgenomics.00213.2005].