| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGGCGCAGGAGCGAGCGCGCCCAGAGUGGAGCUCAGCUGCUGGGAGCCA… | 8595 nt | 0.3291 |
Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Predicted to be located in nucleus. [provided by Alliance of Genome Resources, Jul 2025]
A study in mice demonstrated that chronic alcohol exposure induces significant hippocampal alterations, including decreased mitochondrial ATPase activity, increased H2S levels, and impaired learning ability, alongside widespread differential expression of miRNAs and mRNAs [Du et al. DOI:10.3389/Fphar.2024.1377501].