Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAUUCUUUCUAAGCCGCCCAAAGCGGGGUUGCGCCGGGGCCUCCGGGGC… | 855 nt | 0.5123 |
Summary
This gene appears to represent an intronless retrocopy of a related multi-exon gene located on chromosome 3. However, the CDS of this intronless gene remains relatively intact, it is conserved in other mammalian species, it is known to be transcribed, and it is therefore thought to encode a functional protein. The encoded protein contains six CCHC-type zinc fingers, and is thus thought to function as a transcription factor. [provided by RefSeq, May 2010]
Forensic Context
A study in mice demonstrated that the ZCCHC13 was identified as a candidate forensic biomarker of hypothermia, showing a 0.539-fold reduction in expression in hypothermia-exposed murine lungs compared to controls [Takamiya et al. DOI:10.1016/J.Legalmed.2020.101789].