| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUGAGUGAGCGAGCGAGCGCCGCGCGCGCCGCCGCUGCCACCUCCGCU… | 5045 nt | 0.5921 |
Enables protein-cysteine S-palmitoyltransferase activity. Involved in negative regulation of cGAS/STING signaling pathway; negative regulation of innate immune response; and peptidyl-L-cysteine S-palmitoylation. Located in cytosol. Is active in Golgi apparatus. [provided by Alliance of Genome Resources, Jul 2025]
A study in Wistar-albino rats demonstrated that the ZDHHC18 gene, identified as part of a relevant injury-response network, was down-regulated at 12 hours post-mild traumatic brain injury and subsequently up-regulated at 48 hours [Colak et al. DOI:10.1016/j.injury.2012.01.021]. In human hematopoietic stem cells from cord blood, the ZDHHC18 was identified as a target gene for miR-19b and miR-19a, which showed differential expression patterns influenced by both genetic and environmental factors in twin studies [Ajami et al. DOI:10.22074/cellj.2019.5683].