Basic Information

Symbol
ZEB1
RNA class
mRNA
Alias
Zinc Finger E-Box Binding Homeobox 1 AREB6 Zfhx1a Zfhep FECD6 TCF8 BZP Transcription Factor 8 (Represses Interleukin 2 Expression) Posterior Polymorphous Corneal Dystrophy 3 Zinc Finger E-Box-Binding Homeobox 1 Negative Regulator Of IL2 NIL-2-A PPCD3 ZEB Zinc Finger Homeodomain Enhancer-Binding Protein Delta-Crystallin Enhancer Binding Factor 1 NIL-2-A Zinc Finger Protein Transcription Factor 8 DELTAEF1 NIL2A TCF-8
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_001174096.2
Sequence length
5937.0 nt
GC content
0.3894

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1445.80 kcal/mol
Thermodynamic ensemble
Free energy: -1566.88 kcal/mol
Frequency: 0.0000
Diversity: 1398.68
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
........(((...(.(((.(((.((....)))))))).)...)))((((((.((((....((((((....((((.........))))....)))))).(((((.....(((((((.((((.((...((((......(((((.(((((((((((((((....(.((((((.(((((((((((((((..((((((((((.(((....)))..((((.(((((........((((((.(.((...(((((((....(((((((.(((..(((((((((..(((((..((((((((((...........((((((...)))))).(((((((.((((((.((((((.....((.((((((.((((((((.(((((((((((......(((((((.....(((((.(((...))).)))))...........((((((((((((.(.((((.(((....)))...(((((.(((((........((((.(((((.((..((((((((.(........).))))))))..)).)).)))(((((((...)).))))).))))......))))).)))))..................((((.((((.......)))).)))).((((((((.(((((((((((........(((((.......(((((..(((..(((((((((...((.......((.....)).......))))))))))))))..)))))......)))))......))))).(((((.((((((((((((...........((........))(((.......(((((..((((.......)))).)))))........)))..)))).))))))))))))).((((.....)))).........(((........))).....(((((..(((((...(((....)))...)))))..))))).((((((.((..((((((((.(((.((((..(((((((((...(((......)))......................(((........)))..(((((..((((((.((((((..............((((((.((.((....)))).))))))))))))...)))))).....)))))((((((..........))))))....)))))))))(((.......)))..(((.((((((((.(((((((((((..(((((((((((.((((((.(((.((((.......((((.(.(.(((.(((((((.(((((...)))))))))))).))).).)..))))........)))).))).))))))))))))))..)))...(((((..((....)).)))))....((((....(((((((.........((((((...............))))))...........(((((.(((((((............................))))))).)))))...((..(((((((((((((((((..((((((...((((...((..((.(((.....((.((....)).))...))).))..))...))))....)))))).))))..))))))....))))))).))))))))))))).(((..(((((((((...(((....))))))))))))....)))...............)))))))).)))...........(((..(((((((..((((((((((.((.(((((((((((..((....)).))))).)))))).))((((((........))))))...((..(((.((((......((((((.((((((((.....(((.....(((((...(((((......)))))..))))).........(((((((((((((.........))))))).))))))....((((((((..(((((((..((((((.....))))))))).)))).))))))))....(((((.....((((..(.......)..))))........(((......)))...(((....))).........)))))......(((..((((.((((....)))).)))).))).........((.((((...((((((((........))))))))...)))).))..(((((.(.((.(((.(((((((((((((.(((........(((((....)))))(((((((((....(((.(((((.(((.(((.(((.((.....((((((((((............................))))))))))...))))).))).....(((((.........)))))((.(((......))).)).))).))))).))).........((......)).)))))))))...(((((((((.((((.....(((((((((.((..(((((((...............(((........)))..(((..((((...((((....)))).....))))..))).((((.((((((((((((.(((..((...((((............(((((((((....(((((.....))))).....(((.(((......))).))).((((.......)))).......((((......))))))))))))).........((((((..((....)).))))))...((((((..((((((.....))))))))))))((((.............))))...........((((((((...(((((.((....)).))))))))))))).....((.((((((.(((........)))))))))))...))))..))..))).)))))))))))))))).....)))))))...........(((......))).....)).))))))))))))).((.((((.((.((.((((.....)))).)).)).)))).))....))))))))).((((.........))))...((((.(((((......)).))).)))).......(((....))).(((.((((..((((...))))....)))))))...((.((((....))))))..(.(((.((((...)))).))).)))).))).))))).)))))...))))).).)))))......)))......))).)))))))))))....)))).)))..)).)))))))...........((((......)))).......)))...)))))))..))))))).)))).)))..)))).)))))).))))).)).))).)))))))))..........)))))))))))).).))))))))))))((((...)))).((((((.(((((((((...............(((((((((((..(((((.......))))).(((((((......((((((((...))))))))..........(((((.(((((...))))).))))).....)))..))))((((.(((((((.......))))))).)))))))))))))))((((...(((....................)))...))))...............................(((((.............)))))..((((..(((((.((.(((((((..((((((...........((((((((((((.(((.((...((((((((((((((((((..((.(((...)))))...((((((((((.........((((((.....((((((((.....))).)))))......))))))...((((..(..(((((((((.(((..((.((((((((.((((((((((((....))))))))..((.....))..((((...(((((((((((.((((((((((((((((.(((((..((.((((((((((((((.......((((.....)))).....))))))..............(((((((((((...........)))))))))))....(((((...))))).......)))))).)).))..))))).(((..((....))..))).))))))))..))))))))..)))))))).....((((.(((........))))))).....((((((.(((((((((((.......))))))..))))).)))))).....))).))))...(((.((.(((((.......))))).))..)))((((((....))))))((((((.(((.((........))))).))))))(((((((((((.........)))).)))).)))................(((((........)))))...)))))))))))).)).))))))))))))..).))))...)))))))))).................................(((((.(((((((((((((..(...(((((........(((((.(....).)))))....)))))....)..))))))..))))))))))))......))))...))))))))))))))...(((((((.((........)))))))))...((((........)))).......((((((((((((((.((((.((...........)).)))))))))).((((((........))))))..................(((((((((...((((((.....))))))(((((.....(((((...(((((((((..............((((((((.......(((((....)))))........))))))))........................(((((......)))))))))))))).))))).....))))).............(((((.....((((....(((((((((((....((((((((((.(((((((.....(((.(((((((((((((((((......)))))......((((((.((..(..((((...))))..)......)).)).))))(((((....))))).)))))))))((((((..((((...((((((......))))))))))...))))))))).)))..))))))).))))....)))))))))))))))))....))))......)))))..........((((..............))))......))))))))).....))))))))((((...))))..))))).))))))))))))......)))))).))))))))).)))))...)))).))))))))).))))))..)))))))))))))))).)).))).....))))).))).))))).......((........))......)))))))))))))))))))..........(((((....)))))(((((((..(((((...((((((....((.(((((((..((((.((....((((((.((.((...((((((...)))))).((((........))))......)))).))))))....)).))))))))))))))))))).)))))))))))).)))).)))))))))))...))....)))))))))).)))..............((((((....)))))).))))...)))))))...)).).)))))))))))))))...)))).))))))...............((((((((......)))..)))))..)))))).))))))))).........((((.(((......((((...)))).....))).))))((((((....))))))..............)))))).)....(((((........)))))))))))))))........))))).))))).))))..)).))))...)))))))....))))).....((((.((((.((....))..))))))))............)))).)))))).
Thermodynamic Ensemble Prediction
........(((...{.(((.(((.((....)))))))).}...))){(((((.((((,...((((((....{{{,.........}}}}....)))))).{((({.....{((((((.((((.((...{{{{....,.(((((.((((({{((((((((..,,{{{{{{(({(((((((((({((((,.((((((((((.(((....)))..,,((,(({{{.....,{.((((((.{.((...(((((((..,.(((((({.(((..((((((({{..(((((..((((((((((.....((((..((((((...}))))),((((((({((((((.((((({..,{{{({(({{{(.((((((((.(((((((((({.....,(((((((.....(((((.(((...))).)))))....,....,.((((((((((((.(.((((.{((..,,|||{{((,,(((.{((,...}}....|||.,||||}.({.((((((((.(.,....,.).))))))))},,,.,,.,,,((((({,...,).))))),|||,......}}}}}.,}})}||....,...........((((.((((.......)))).)))).(((((((({(((((((((((,.......,||||,|{,...((((({{{{(..(((((((((...{{.......{{.....}}.......),))))))))))))}.)))))},,...}}},,......})}}}.(((((.((((((((((((...........{{........)}(((.,,....(((((..((((.......)))).)))))........)))..)))).))))))))))))).{{((.....}|||........,||{....,...}}}.....(((((..(((((...(((....)))...)))))..))))).{{((((.{(.{((((((((.((({((({..((((((((({,,(({......|}|{,,.,....||.....{{,{{{({.........,,,..{{{{,..||||||}|,,{{,..........,...{(((((.{{.((....}},,.))))))))))))...}}}}}}....})))}}((((((.,.....,,.))))))....)))))))))(((.......)))..(((.((((((((,(({((((((((..(((((((((((.((((((.(((.((((.......((((...{.(((.(((((((.(((({...}))))))))))).))).,.,..))))........)))).))).)))))))))))))}..))){{,((((({,{,..,{||.||||,....{{{(....(((((((.........((((((.....{{......,,))))))........,..(((((.(((((((,|.....,,.................,.})))))).)))))..,{(..(((((((((((((((({..{(((({...{{({...{{..,({((((((,....})))...})))}...,,.,,..}}...}})}....}))))).))))..)))))...})))))))).})))))))))))).||,}}||||||{{|}}}||.}}}}),}},||||}},....,,,..,}},.........)))))))).)))........,..(((..(((((((,.(({(((((({.,,.(((((((((((..((....)).))))).)))))).||(((((({,.....})))))).,}|{..(((.((((......((((((.((((((((.,,,,(((...,,|||||...(((((......)))))..}}}}}.........(((((((((((((.........))))))).)))))}....((((((({..{((((((..((((((.....))))))))},)))).,)))))))||{{({{{(,,,{,((((..{.......,..)))).........,,......|||.,.(((....)))..}},....}}|||......(((..((((.((({....)))).)))).}}}..,,....,||,,,,{..,((({,,,,.}}},...))))))})},,)}}|..|..(((((.(.((.(((.(((((((((((((.(((.{,........((((((({{{{(((((((((....(((.(((({.(((.,{(.(({.{,.....{(((((((((.,,.{{.........}).,}........)))))))))}...,,}}},}}|{{,..{.{|{{{{.......,)))|,,{||......})),}..}}}.})})).))}.........{{......)).))))))))}{|||,.||||,....,}}))},..,))}},,,...,,||||...,,,,..........,,|........,),,,,,((((.(.(((((({...,(((..(((((((((((.((((((.(((...((((((.,(((....))).}...))))))...))).))).)))...(((((.....)))))..........))))))){(((,.,{{({{{.......}}}}....||,((((......))))..}}}}}.,......,..((((((..((....}).))))))...{(({(({{((((((.....)))))))))))}((((.............))))...........((((((((...(((((.((....)).))))))))))))).....{{.((((({,(((........)))))))))}}.,,}}...((((((.((.((((((((({.,{{{....,,}|,.,,.....,,,..,,,...}}.,)),.(((((..{.(((((((..((.,......))....)))))))}..)))))......,.))).))))))))))))))).,||,.......|}},|,.{((((.(((((......)).))).))))}......(((....))}.(((.((((..((((...))))....))))))).))))..)))))))))).}.))))(((.((((...)))).))),,))).))).))))).)))))...))))).).)))))......}}}......)))}})))))))))).}..))}).)))..)}.}))))))...........((((......))))...,,..))),..)))))))..)}))))),,))).)))..)))),}))))).))))),)).)))}.}})))))}....,}},...))))))))))).).)))))))))))){(({...,})).((((((.(((((((({....,,{,{{{,...(((((((((((..(((((.......))))).{{(((({......||{{{{{{..,|}}}}}}}..........{((((.(((({...))))).))))},,..,}}},,,},,((((.(((((((.......))))))).)))))))))))))))((((...((,....................,,,...,,}}.........................,.,.,.,.,.............,.)))))..}|,...(((((.((.(((((((..((((((........,..((((((((((((.(({,({.,.((((((((((((((,,,,..{(.(((...)))}}...((((((((({......,,.((((((....,((((((((.....)))},)))),}....)))))).,.{(((..(..((((((((({(({..{{.((({(((,,((((((((((({....}}}}}}}}.{(({{{......||||},.,,,((((((((.((((((((((((((({.{{,{({{{{,{{,{{{({((((((..,,...((((.....)))).,,..))))))........,.,,,.(((((((((((...........)))))))))))....,{{{{..,|||||,{...{{|||},,.,)}))}.))))),|||,}|,..,,}}}}}}}.})))))))..))))))))..)))))))).....((((.(((........))))))},,...((((((.(((((((((((,....,,))))))..))))).)))))).....))},||||..,(((.((,({{{{....,,,))))).)),,)),((((((....)))))){(((((.{{,{((........)))}}.)))))}(((((((((((.........)))).)))).)))},}}}}}.........(((((........)))))...))))))))}))).}}.))))))))))))..).)))}..,}))))))))).....{{{{{...................,|..(((((.(((((({((((((.,,...(((((........(((({.{....).)))))....)))))....}..))))))..})))))))))))......,)))},.))))))))))))))...(((((((.((........)))))))))...((((........)))).......{(((((((((((((.((((.,{{{.......,.}}.)))))))}}}.((((((........))))))..................(((((((((...((((((.....))))))(((((.....(((((...(((((((({.{{{..........((((((((.......(((((....)))))........))))))))........,,,.......,...,,(((({..}},})})))))))))))).))))).....))))).............(((((.....{{{(....(((((((((((....((((((((((.(((((({,.,.,(((.(((({((((((({{{{({{,{,,}|}})},}},.{{{{{{.{(,,(,.{(((,,.}}}|.,||..,,.}}.,,.}))}{||||,,..}}))),)}))))))),,,,,,...,,,...((((((......))))))}}}}...}})},}))).)))).))))))).))))....)))))))))))))))))....))}}......)))))..........|{{{,{{{...,,..,},}))}......)))))))))....})))))))}{||{...}))},.})))).)))))))))))).,,,..)))))).))))))))).))))),,,})},.))))))))).))))))..)))))))))))))))).}},}}}.....))))).}}}.}},,........{{,,,.....}}.},,..)))}}))))))))))}}}|,,,..|||,.{((((....))))}|||||||,,||||{..,||||||}}}}||.{{{,,||}}||||,{||,..((((((......}}}}|||||..,|{{{{{..((({........,,,.,.....)))),..)))))},,|{|||||||}}},,.}}}},,.))))))))))))})))).)))))))))))...}}....)))))))})}.}}},,||,,{{{{{...{{{,,{,,.})))))},)))),,.)))))))...)).).))))))})})},))))}.)))).))))))...............{(((((((......)))..))))}..|}}}}|,}}))}))}|,|,,.....,{{,.{{{,,,...,|||}},|}})}},..})),))),((((({....})))))........,,,....}}})).)}}}}||{||},,}}..,))))}))))))}},}.}}}},..})))).))))).)))}..}}.}))}...}))))))}},,))})}.....((({,((({.{{....}}..})))))))...........,)))).)))))}.

Transcripts

ID Sequence Length GC content
AGACACAAGCGAGAGGAUCAUGGCGGAUGGCCCCAGGUGUAAGCGCAGA… 5934 nt 0.3893
Showing 41 to 41 of 41 entries
Summary

This gene encodes a zinc finger transcription factor. The encoded protein likely plays a role in transcriptional repression of interleukin 2. Mutations in this gene have been associated with posterior polymorphous corneal dystrophy-3 and late-onset Fuchs endothelial corneal dystrophy. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Mar 2010] CIViC Summary for ZEB1 Gene

Forensic Context

A study in humans demonstrated that the long non-coding RNA MIAT is significantly overexpressed in non-small-cell lung cancer (NSCLC) tissues and that its C-containing genotypes at SNP rs1061541 are a protective factor against NSCLC [Zheng et al. DOI:10.2147/CMAR.S163395].