| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCCUGACUUCAGCGCUCCCACUCUCGGCCGACACCCCUCAUGGCCAAC… | 1747 nt | 0.5718 |
Enables several functions, including 14-3-3 protein binding activity; mRNA 3'-UTR AU-rich region binding activity; and protein-RNA sequence-specific adaptor activity. Involved in several processes, including cellular response to cytokine stimulus; cellular response to epidermal growth factor stimulus; and regulation of gene expression. Acts upstream of or within mRNA catabolic process. Located in cytoplasmic ribonucleoprotein granule; cytosol; and nucleus. Part of ribonucleoprotein complex. Biomarker of breast cancer. [provided by Alliance of Genome Resources, Jul 2025]
A study in mice demonstrated that the ZFP36 transcript, identified as Zinc finger protein 36, C3H type-like 3, was an individual predictor for postmortem interval (PMI) in brain tissue, yielding an R² of 0.61 [Hunter et al. DOI:10.1016/J.Forsciint.2017.02.027]. This research validated that selected groups of gene transcripts provided more accurate PMI predictions than individual transcripts, with a set of seven mouse brain genes achieving an R² of 0.95. A study in Wistar rats demonstrated that the ZFP36 mRNA expression in iliopsoas muscle was significantly increased in severe hypothermia compared to control and mild hypothermia, identifying it as a potential marker for hypothermia severity [Umehara et al. DOI:10.1007/s00414-018-1888-3].