Basic Information

Symbol
ZFP36
RNA class
mRNA
Alias
ZFP36 Ring Finger Protein RNF162A NUP475 G0S24 TTP Tristetraprolin TIS11 Growth Factor-Inducible Nuclear Protein NUP475 MRNA Decay Activator Protein ZFP36 G0/G1 Switch Regulatory Protein 24 Zfp-36 Zinc Finger Protein 36, C3H Type, Homolog (Mouse) Zinc Finger Protein 36, C3H Type, Homolog Zinc Finger Protein 36 Homolog Zinc Finger Protein 36 Tristetraproline TIS11A GOS24
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference Cause of death analysis

MANE select

Transcript ID
NM_003407.5
Sequence length
1747.0 nt
GC content
0.5718

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-607.60 kcal/mol
Thermodynamic ensemble
Free energy: -638.65 kcal/mol
Frequency: 0.0000
Diversity: 537.44
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..........((((((..((((((((((((((((......(((((((.((((......))))...))...)))))...(((.((....)).)))..(((((..(..((((....(((((((......)))(((.(((((((.......((((.(((((((..((...)).))))))).)))).....)))).))))))...(((((.(((((.((((((((..((((.((((((.......))))))))))))))..))))..))))).))))).....))))...))))..).)))))...((.(((((..((((........))))........)))))..))....................(((.((....)))))..)))))).))......)))))))))))))).((((.(((((((..((((.((((((((((.....))))))))))))))..))))........(((.(((((((((((((....)))))...............(((((((..(((.....)))....(((((((((((...............))))...))))))).(((((((......((((((((.....))))).)))....((((((..(((....))).)))))).................))))))).)))))))......((((((((..((((...((.(((((..(((((((((.(((.(((((((((....(((((((............(((((((((((((((.......(((...((.((((.........)))).)))))....(((((.(((((((...((((........))))))))))).)))))...((.(((((.(((...............))).))))).)).........))))))..).)))))))).((((((((..(.((..(((((((((...)))))))))..)).)..)).))))))...)))))))..((((((((...............((((.((.........))))))....(((.((.((((.(.(((((.....))))).).)))).)).)))((((..((((..(....)..)))).))))..(((((..(((((.....((((((..............)))))).................)))))..)))))......)))))))).))))))))).))).......(((.......)))))))))))).))))).)).....))))..).))))))).((((((..(.((...((.(((((((((((((((......((((((.....................((((..(((((.((.....((.(((((.........))))).))......)).))))).))))..(((((((((((..((...))..)))))))))))......)))))).....((((.......))))........((((...((....))..)))).........(((((......)))))(((..(((.(((((..(((.((.....((......))...)).)))..))))).)))..))))))).))))))))))).))....)).)..))))))...((((((.......)))))).........((((((((((((((((((........))))))))).........))))))))))))))))).)))..................)))))))...
Thermodynamic Ensemble Prediction
.,,,,,....((((({.,((((((((((((((((...{{(((((({{.{(({......})))...}|...}}}}}...{({|((,,..,,,|}|,.|{(({..{.,({({..|,{{{,{{{|...,}))|(((.{{(((({,,{{,,,((({,(((((((..((...}|.))))))},||}}.,,,.)}))}}))}}}|..(((((.(((((.((((((((..((((.((((((.......))))))))))))))..))))..))))).))))).....}))}...)}}}.}}.))))),,,||,|||||..{({{.,,.....}}}}...,,,,.|}}}}..}}................,,}.|,,.,.....})))}..)))))).))......)))))))))))))),(({,.|||((((..((({{((((((((((.....))))))))))))))..))))........,((,(((((((((({((,,,,,}}},...}}}}},......{((((((,,({{.....))),,,,(((({{{,,{{............,},))})}..})))))),{{(((((......(((((({{,....))))).)))....((((((..(((....))).)))))).................))))))).})))))}....,,((((((((..((((...((.(((((..(((((((({.{{{.{((((({({...,(((((((.....{,.....{(((((((.({((({.......(({.,.,{|||{{,,,.,{{,{|,||,||{{{.,,.{((((.(((((((.,,({,,.........)))))))))).))))).,.((.(((((.(((.........,.....))).))))).)}.,.......,)))))..).)))))))).||(((((({|,.{{..(((((((((...)))))))))..,,.,..||,|.,,,}...))))}))},|||||||{.....,,.....,....(({....,},...,)})}}}|...{((.((.((((.{.(((((.....))))).).)))),)),}}}|||...,|{|,,|,||||,,}}},.))))}.|||||,.|||||}}..,||||||}}},......,...}}}}},......,,.,|,.....,}}}}..,}}|||.,,{{||||||||.,}}}))))).)))})..,}.|||},...,.}),))))))))).))))).)}.....))))..}}))))))}.{{((({..,.{{...{,.(((((((((((,{({.,,...{({(((.....................((((..{((((.,,...{.((.(((((.........))))).)).,....}),))),,.))))..(((((((((((..({...))..)))))))))))....,,)))))).....{{{{,,.....,,,,........{{{{,,,((....}}.,)))).........(((((......))))),,,..{{,.{{{((,,(((,.{,.{({...,,,{{}}....,.})),,)}}}),)})..)))))))}))))))))))).},....},...,}}}}}},,.{(({{{.......}))}}}.........{(((((((((((((((((........))))))))).........))))))))))))))))),))),.................,,)))))...

Transcripts

ID Sequence Length GC content
AGCCUGACUUCAGCGCUCCCACUCUCGGCCGACACCCCUCAUGGCCAAC… 1747 nt 0.5718
Summary

Enables several functions, including 14-3-3 protein binding activity; mRNA 3'-UTR AU-rich region binding activity; and protein-RNA sequence-specific adaptor activity. Involved in several processes, including cellular response to cytokine stimulus; cellular response to epidermal growth factor stimulus; and regulation of gene expression. Acts upstream of or within mRNA catabolic process. Located in cytoplasmic ribonucleoprotein granule; cytosol; and nucleus. Part of ribonucleoprotein complex. Biomarker of breast cancer. [provided by Alliance of Genome Resources, Jul 2025]

Forensic Context

A study in mice demonstrated that the ZFP36 transcript, identified as Zinc finger protein 36, C3H type-like 3, was an individual predictor for postmortem interval (PMI) in brain tissue, yielding an R² of 0.61 [Hunter et al. DOI:10.1016/J.Forsciint.2017.02.027]. This research validated that selected groups of gene transcripts provided more accurate PMI predictions than individual transcripts, with a set of seven mouse brain genes achieving an R² of 0.95. A study in Wistar rats demonstrated that the ZFP36 mRNA expression in iliopsoas muscle was significantly increased in severe hypothermia compared to control and mild hypothermia, identifying it as a potential marker for hypothermia severity [Umehara et al. DOI:10.1007/s00414-018-1888-3].