Basic Information

Symbol
ZG16
RNA class
mRNA
Alias
Zymogen Granule Protein 16 HZG16 JCLN1 ZG16A Jacalin-Like Lectin Domain Containing Zymogen Granule Membrane Protein 16 Secretory Lectin ZG16 JCLN Zymogen Granule Protein 16 Homolog (Rat) Zymogen Granule Protein 16 Homolog
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_152338.4
Sequence length
3116.0 nt
GC content
0.4926

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1079.9 kcal/mol
Thermodynamic ensemble
Free energy: -1130.82 kcal/mol
Frequency: 0.0000
Diversity: 709.01
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...........(((....)))(((((((.((.(((...((...(((((((((........))))))))).(((((((..............((((..((((.((((...))))...)))).))))..............)))))))..((((((((((((((...((..(((.......((((...))))..)))..)).))))))))).))))).(((((..(((..(((((((((....((...(((((((((((.(((((......))))).((((((((....))))))))..((((((((((((........((((.((...)).)))).......)))))))))))).............))))))))))).)))))))..))))...)))..)))))((((.((((((((....))))))))))))...))...))).)).)))))))....((((((((((((.(((.((((((((((((((((((((..((((((.......(((...)))....((((((........)))))).(((.((((....))))))).((((((..((((..((((....((((((((((((....))).)))))))))....))))..)))).((((((............(((..(((((((((((...((((((((((((.((((((((...((........)))))))))).)))..)))...))))))....)))))))))))..)))(((((((((.(((((((...((.(((...(((..(((((....(((((((((((.((.....(((((.......)))))((((((((.(((.(((((.(...((((((((....)))))))).).))))).))).)))))))).........)).)))))))))))......))))))))....)))))....))))).))))).....(((((((((((((.....(((((....))).)).(((((.(((((((...(((...((((..(((((((.((((....(((((...(((.......)))((((..((..(((.(((...(((((((...(((((..(((.((((....))))..))).)))))(((((((...(((((.((((..((((((......(((((((.(((..((((((........))).)))....((((.(((((((.((((((((.........))))....))))....(((....)))...)))))))....)))).))).))).)))))))))).))))....(((((....)))))))))))))))))....)))))))))))))..)))))).....)))))....)))))))))))))))...)))))))))).))))))))))))))..))))...(((((((((........)))))))))))))))..))))))....((((....))))....))))))....))))))..)))))))....(((....)))..)))))))))))))(((....)))......))).)))))......))))))).((((((((.(((((.(((((........(((((...(((((((((.((((((((((.....(((((((.((((((((((((.((((((....)).))))...)))))).((((((....))))))...((((.....(((((((((((((((((((......)))))))..(((...)))(((((.((((........................)))).)))))...........(((((....)))))((((((.((...((((((((((((((((((((.(((((..((........((((...))))))..)))).).)))))..((((((((((...(((((((..................(((((((((......((((..........(((((..(((.........))).......)))))...........))))....))))))))).((((((((....(((((((((.(((((.......((((((((((((((((((((..((((.....(((((.....))))).......)))).)).)))))((((.((((....)).)).))))..(((((((((.((((((.....(((((((......).)))))).....)))))).)))))))))..)))).))))))))).......))))).............((((......))))....((((((..((((...((((((((..(((...)))..))))).)))...))))(((((((((.(((((.(((........))).))))).)))))))))...))))))..))))))))).....)))))))).....((((((((......(((.(((.((((((..(.(((.......))).)...)))))))).).)))...(((....)))...))))))))..)))))))...(((((((((.((......))...((((.((.((((....((((.....((((.(((.....))).)))).....))))....)))).))...)))))))).)))))......))))))))))(((..(((........)))..)))(((((.(.((((((.((((...)))).)....)))))).))))).((.((((...)))).)))))))..))))))))(((((((((.(((...)))))).))))))....))...)))))))).)))..)))))))))...))))...(((((.(((........))).)))))..((((((((((.(((....))))))))))))).....(((......))).........)))))))))))))((..(((((.((((..(((...))))))))))))..))...(((((......)))))..(((((.(((((((((((...))))))...)))))...))))))))))))))).....)))))))))(((((...((((((((.....................))))))))..))))).))))).....))))).........))))).)))))))).
Thermodynamic Ensemble Prediction
.........,{(((....)))||(((((.((.,{(,{,,({,,(((((((((........))))))}||,((({(((...,,....,,,,,((((..((((.((((...))))...)))).)))}....,,,,......))))))).|((((((((((((((...|(,.||.||.||..((((...)))).,})}.,|}.))))))))))),)))}(((((..(((..(((({({((....{{.,.((((((((((((((.{,{{....,,}...((((((((....))))))))..((((((((((((...,....((((.(,...}).)))).......)))))))))))).......,.})},})))))))))).,)))))),.))))...)))..)))))((((.((((((((....))))))))))))...}),},))),)).)))))),....((((((((((((.(((.{(((((((((((({{{((((({((((((,,{{...|((|{{}}|{.((((((((........)))))).)).,{{(({{{{|}{(((((........((((..((((....((((((((((((....)))))))))))))....))))..))))..)))))}............,,.,(((((((((((.,.((((((((((((.((((((((...((........)))))))))).)))..)))...))))))..,.)))))))))))}.)))}}}}{{||,.|||||{{.,,||,|||,..((,.,(((((....(((((((((((.((.....(((((.......}}}}}((((((((.(((.(((((.(...((((((((....)))))))).).))))).))).))))))))....,,...)).)))))))))))..,...))))))))....}}))),,,.}}))}.|||||||{{{(((((...(((((,({.((((...((.{(((({.....}))))}.))....}.))).)))))))......,{{{{(({(,((((((((((((((.(((.((((((((({,...(((({.{((((((...(((((..(((.((((....))))..))).)))))(((((((,..{((((.((((..((((((......(((((((.(({..((((((........))).}))},,,((((.(((((((.,(((({((...,,,},,}}}}....}}}}....(((....)))...)))))))....)))).))).))).)))))))))).))))....(((((....)))))))))))))))))..,.)))))}}|||.,|,.,,..,,,.}}}..,...||||||}}},,||{|||,....,.)))))})))))))))))))))...))).....)))))}||(({((........,,,,})))))))))).,)))},((((....)))).....)))),.},.,))},..})))))))}}}.(((....}})}.})))))))))))|(((....))),.....))).)))))......))))))).((((((((.(((((.(((((........,{(((.{{(((((((((.(,,(((,,{({{{{{(({(({,,{{{{{(((((((.((((((....}}|})))...)))))).,(((((||.,||,}}}..}||,(,,,..,,{{||||{{{,(((((((......))))))).,(({,.,.,},|||||,..,,.............,,,,.{|||{|||{,,,||,,||,}}}...,((((|....}))))((((((.((.{{({((((((((((((((((((.(((((..((.....,,.((((...}}}}})..)))).}.)))))..((((((((((.,.{((((((.,,,..........||..(((((((((...,..,{((..........(((((..{((.........))}.......)))))...........}})),...))))))))).((((((((....(((((((((.(((((.......((((((((((((({((((,{..((((.....(((((.....))))).......)))).},.))))|((((.(({{....,,.)).)))),.(((((((((.((((((.....(((((((......)}}))))).....)))))).)))))))))..)))).))))))))).......)))))............,((((......)))),...(((((({.((((...((((((((..(({...}))..))))).)))...))))(((((((((.(((((.(((........))).))))).))))))))).}.})))))..))))))))).....)))))))).....((((((((....,,{{{.(((.((((((...,{({,....,.))).,...)))))),}.},}}}..,{{(....}}}...)))))))),,))))))}...(((((((((.((,,{{,,{{...{|||,||,{{((....((((,.,{,((((.(((.....))}.)))).,,,,}})}....)))),})}})))..)))).)))))......))))))))))(((..(((........)))..))){((({.,.(((((|,{({,...}))),)....)))))..})))}.((.((({...}))).)))))))..))))))))(((((((((.(((...)))))).))))))....,,.,})))))))).}})..|||||||,|,,,|}||,{.(((((.(((........))).)))))..((((((((((.(((....))))))))))))).....(((.,....|}|,,.......)})))}))))))}{{..{{||{,|{{|,,|||,.,))}|||}}}})).}))..||||||..,,,,))}))}.{{{((.{{{{{{((({,...,)))})},,))))),,.))))))))}}}},},})}}})))))),,).||||}},((((((((.....................)))))))).}))),,.})))),....))))).........))))).)))))))).

Transcripts

ID Sequence Length GC content
AUAAAACAUCUGGAAGUUUCCAGGGGGCUGCUUUGCAUCUGAAACUGUC… 3116 nt 0.4926
Summary

Predicted to enable carbohydrate binding activity and peptidoglycan binding activity. Predicted to be involved in protein transport. Predicted to act upstream of or within defense response to Gram-positive bacterium and suppression of symbiont entry into host. Located in Golgi lumen and collagen-containing extracellular matrix. [provided by Alliance of Genome Resources, Apr 2025]

Forensic Context

A study in humans developed a multiplex RT-PCR assay for rectal mucosa identification, where the ZG16 was selected as a candidate marker based on characteristic expression in the rectum and was positive in 16 of 19 rectal mucosa samples, with no detection in other tested body fluids when applying a cutoff value, and it showed a positive correlation with PHGR1 [Akutsu et al. DOI:10.1016/J.Fsigen.2022.102712]. Another human study evaluating mRNA-based methods noted the ZG16 is mentioned in the literature as a useful marker for rectal mucosa, though it was not experimentally studied in that work [Martin et al. DOI:10.1016/j.fsigen.2025.103297].