Basic Information

Symbol
ZIC1
RNA class
mRNA
Alias
Zic Family Zinc Finger 1 ZNF201 ZIC Zinc Finger Protein Of The Cerebellum 1 Zic Family Member 1 (Odd-Paired Homolog, Drosophila) Zinc Finger Protein ZIC 1 Zinc Finger Protein 201 Zic Family Member 1 Zic Family Member 1 (Odd-Paired Drosophila Homolog) BAIDCS CRS6
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_003412.4
Sequence length
5260.0 nt
GC content
0.4755

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1665.17 kcal/mol
Thermodynamic ensemble
Free energy: -1764.88 kcal/mol
Frequency: 0.0000
Diversity: 1290.84
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.........(((...(((((((((..((((..(((((.(((.((((..((((.(((((((((((.(((((((.......((((................(((....)))(((.....)))(((((((((((..((((((((((((((((((((((((((.((((((((((..((((((((((((........)))))))))))).))))))))..)).....)).)).).).)))).))))).))))))))))).)))))))))))(((((((.((.((((.((..(((((((((((...))))((((.((((.(((((((((((((((((((((.((((((..((.(((((((..............)))))))))..........(((((......))))).(((((......)))))........(((((.((((((((.(...........).)))))..((((..((((((((((((((....(((.(((((..((.((.(((.(((.....))))))))))..))))).)))...)))))...)))))))))..))))..)))))))).)))))).)))).)).))))..).))))))((((.(((......))))))))))))))).)))).)))))))....)).)))).)).))))))).))))......)))))))))))))))))))))).(((((((((((((((((((((((((((....))))).(((((...(.((((((.((((((.(((..................((((((.(((....)))))))))((((.........))))((((((((((((((.....(((.(((.((((......))))...))).)))...(((((........)))))...(((((((....))))))).)))))))((((....))))...))))))).((((((.(((..((..((((((.(((..(((((((.....((((.((((((((((((.(((((((.....)).).))))...((((((..(((((((.....)))))))....))))))..(((((((((..((((((((((.((.(.(((((.((...)).)))))....(.(((((((....((((((((...((((.........)))).))))).))).....))))))).).....).)).))))))).))).)))))))))..))))))))..))))..)))).)))))))....(((.(((.......))).)))))).)))))).))))).)))).)).))).)))))))))))))...))))).(((.((((....)))).)))...((((........))))(((((((......))).))))))).))))))))).((.(((..(((((.((..(((((...((((.((((((((((.(((((((((((..(((((.............(((((((..................)))))))((.......)).((((.(((((..((((((..(((((((((((((((((....)).))))).)))))).((..(((((......)))))..))......(((((.........)))))..))))....)))))).)))))(((.((((.((((.(((.(((........))).).)).)))).)))).))).....(((..(((..((((((.....(((((((((..(((((.....)))))...))))((..(((((((((((((((((((((..(((...))))))).)))......((((......))))....((..(((..(((((.....(((.(((((((.(((.(((...((((((((((..(((((.(((.....(((((...(((.(((...........((((((((...)))))).))(((((((((((....)))..........(((.((((((.((......(((((((((.(......((((.(((...(.(((((.((.(((((((((...((((...((((((..((..((((((((.(((.(((((((..............((((((.....(((((..................................))))).....))))))....................((((.(((..........(((((.........(((((..((((............((((((.(((....(((.(((((((((((((((.................))))))))).......)))))).)))))).))))))))))(((((...))))).)))))..)))))))))))))))))))))(((((..((....((((....(((((((((((.((.((..........)).)).))))))).))))...))))........((((.(((((......))))).))))......((((..(((((.((((((..........)))))).......))))).))))))..)))))).))))))))))))))))..))))...))))))))).))))))).)...))).)))))))))))))))))))))).)))))))))))...((((...((....))....)))).(((....))).......))).)))...)))))........(((((((......(((..(((..(((......(((((((....(((((((.((((((.(((((.((.(((((....))))).))..)))))...)))))).))))))).....)))))))......))).)))..)))..)))))))))))))))..)))..)))))))...))).........((((((((....(........)....))))))))......((.(((.......)))))....(((((.........)))))..........)))..)))))))....))).....)))))..)))..))...)))))))).))))))..))..((((.((((((........((((......(((.(((((....))))).))).....))))(((....))).......((((.....))))((((.(((((....)))))...))))(((((...)))))..)))))))))))))))...))))))....)))..)))....(((.((..(((..((..(((((((.(((((.(((((((((((..(((((..(((((((((...(((..((((((...)))))))))..))))))))))))))...))))))...........))))))))))...............(((((....)))))..................)))))))..))..)))..)).)))...............))))....)))))..))))..))))))).)))))....))))).)))).)))))....))))))).))))))))))))..........)))))))))).)))))...)))).......((((((((.((((((((((.(((..................)))..............(((((((...((.(((((((....(((.......((((.....)))).....)))...)))))))..))...)))))))(((....))).)).))))))))............))))))))...)))))))))..)))..(((((((((((((((((...(((....(((((...((((..(((((((((.((((((((((((((.............((((((...((((((((((((.......(((.((..((.((.....)).))..)))))......)))))))))))).....)))))))))).)))))))))).((((((((.(((.((((((((((....(((...((((((............(((((.(((((((.........))))))).)))))(((((((((....(((((((((((((..((((.(((((.(((((((((((((((.(((((.(((.......))))))))..))).....))))))))...))))..)))))....)).))..))))))))))(((((((((((((((((.(((((((.......((((..(((((((.((((((.(((.(((((.........((((.....)))))))))...)))..)))))).)))).)))))))........(((((((((((.....((((.((.((((((.......(((....)))....((((.(((((......))))).)))).......((....(((.((((...............)))))))....)).)))))))))))).)))))..)))))).........))))))))))))....(((((((((.(((....))).)))))))))))))))))......)))).......(((..(.(((((((((((...((((((((((((.((((.....(((((....)))))..)))).)))))..)))))))))))))))))).)..)))..)))....))))))))).((((((..((((((...(((((..(((((((.......(((((...))))))))))))..))))).))))))..))))))..))))))...)))...))))))....)).)).))).))))))))...(((....))).....((((.((((((...........)))))).))))....................)))))))))))))....((((....(((((.((((...)))).))))))))))))))....)))..))).))))))))))))))(((((((.(((((((((((((((.((((((((((((....((((....))))...(((..(((........)))..)))((((((((.((.......)))))))))))))))))...)))))..)))))))....(((((((((((((((((((....)))).......(((((((..(((.(((........))))))..)))))))))))).))))....))))))((((((((.(((.(((((.........(((((....(((....)))...)))))........))))).))).))))))))...((((((..(((((((....)))))))..).)))))......)))))).)).)))))))................
Thermodynamic Ensemble Prediction
.{(((.,.((((((((((,.{(({,({,{...,))}},,{{({({(..(({(((((((((((((.(((((((.......((((.{.......{{{{...,{,....))){{{.....)))(((((((((((..((((((((((((((((((((((((((.((((((((((.,((((((((((((........)))))))))))).))))))))..)).,.}.)).)).,.,.))))}))))))))))))))))).)))))))))))(((((((.((.((((.((..(((((((((((...))))((((.((((.(((((((((((((((((((((.((((((..,,.(((((((..{...........)))))))||..........(((((......))))).(((((......))))).....,..(({({|{{{(((({.{.},,,,,..,}}.)))),..((((..((((((((((((((....(((.(((((..((.((.(((.(((.....))))))))))..))))).)))...)))))...)))))))))..))))..)))))))).)))))).)))).)).))))..}.))))))((((.(((......))))))))))))))).)))).})))))).,,.)).)))).)).))))))).))})......)))))))))))))))))))))),}|))|((((((((((((((((((((((....))))).(((((...{.((((((.((((((.(((.{{{,{..{{,,{{{..,{(((((.((,....||||||}}}((((.........))))((((((((((((((.....(((.(((.((((......))))...))).)))...(((((........)))))...(((((((....))))))).)))))))((((....))))...))))))).{|||||}||,},}}}}||||}}},||..|||||,{.{{,.{{{{.((((((((((((.(((((({.....}).).))))...((((((..(((((((.....)))))))....)))))}..(((((((((..({((((((((.((.{.(((((.((...}}.)))))....(,(((((((....((((((((...((((.........)))).))))).))).....})))))),),....}.)).)))))))).)).)))))))))..))))))))..))))..}})},||||||{{{{{(((,(((.......))).))),,)}))),},.})))).}))).,,.))).)))))))))))),...))))){{{,.{(((((.{((((.(((({{((((........)))))))((((......)))).(((((........,......)))))...((({...((,,((.....)))))..))))..))))}}}}.)))))})}}............{,((((({......,,....{,....)))}}))}},,}},..))}}}.}.(((((..((((((.{((({(((((((((((({....}).)))))}}))))).((..(((((......)))))..))......(((((.........)))))..}}}),,}.)))))).)))))(((.((((.((((.(((.(((........))).).)).)))).)))).))).....(((..(((..((((((.....{((((((((..(((({.....)))),...))))|{,,(((((((((((((((((({((,{(((...,,,)))),,}|,.....((((......))))....{,|,{{{..{{{{{,,{(((((,{(({(((,(((,{((...((((((({{({{(((((.(((,,..,((((({{{(((.,,(({.{{{{....,,||||,|}}..)))))},,((((((({(((....))}.........{(((.((((((.((......(((((((((.{......((((.(((,..(.(((((.{{.(((((((((,,,((((...((((((,,((..((((((((.((({(((((((,,{,.,..,.,.,,((((((.....(((((..................................))))).....))))))......,,.....|,|{{,.,{{{,{{,..........(((((.....{{{{((,({,.((((............((((((.{((...{(((.(((((((((((((({.................,}))))))).,,,,,.))}))}.))))}}.))))))}))),|||({{{|,,,)})))}}..,))))))},)))))}||}|||{,|||..||....{({(,...(((((((((((.((.{(..........)).)).))))))).))))...}))),,,,,,,.,,...}}}|,...,,,,..((((((((,.,((((.............)})}))))))))).,,,},.......,))}}))))}))),))))}).)))))))))})))))}..))))...))))))))),))))))).}.,.))).)))))))))))))))))))))).)))))))))))...((((...((....||.,..}))).{({....}}}.,,..,})))}}}|...||||}...,,,.,(((((((......(({..(({..(((......(((({(({{{||((((({.((((({.{((((.{{.{((((....))))).},..})))}...}))))).)))))))))),..})))))......))}.}}}..)))..})))))))))))))},}))}..)))))))...)))}}}.}}|..||||,|||,,}}{.,,,........|)))}||||,...,,||,,,|,,},.,,}|}}},,,,||{{,.........|}}}}.........,,,,...,,,,}},,..)))}}}..))})),}))}..,,...}}))))))}))))))..}}..((((.((((((....,,,.({{{......(((.(((({....})))).})).....))))..,,,...{{{{,....||||,...,}},,((((,(((({....})))).,,))))(((({...}))))..)))))))))))))))...))))))...,}}}..})),...))))))))))))))))),..,{{{.(((((.(((((((((({..(((({.,(((((((((...(((..((((((...)))))))))..))))))))))))))...})))))...........)))))))))).,...........,.,}}))))))).,)))}...................((((.((..((((....(((((((.........,..(((,...,)))...,((,{,(((({((.,.((((({,,{{,,.,}})...))))))..},)})}})).,,||{(,...((......))...)))|{{{{{,|,|{|{((({{((((.((((...}))).)))))))).({{...,,,.......,,...))}...,}}}...}}}}}}))))))).))))..)).)))).(((.,,....,,,,......|{{{((((((.......))))}}.}|},.{{{{{{(({,.,,,{|.|.{{{{{......}}}}},.,,..|||{{|,||||||||...,||||...(((((((((((((((({...(((....{(({,...((((..(((((((((..,,{{,,,,((.(((((((({{..,,,((((((,,.((((((((((((,.,....,,({(,.(((..,..}}).).))}..,,,},,.,..)))))))))))).....},}}},.,,|.||,,,,,|{(.((((((((.(((.((((((((((....(((.,.((((((.,,.,,...{,,(((((.(((((((.,,....,,))))))).)))))(((((((((....(((((((((((((..(((({(((((.{((((((((((((((.(,((({.(({{......)))},))}}.),}}..}))))))))..,}})}..)))))...,)).))..)))))))))|(((((((((((({((({{(((((((.......((((..(((((((.((((((.(((.(((((.........((((.....)))))))))...)))..)))))).)))).)))))))..,,....((((((({{({.....({,{{((.((((({....{{(((({,....}}}}}||((.(((((......))))).))}}.....{{(,.......}}|{,,.....,,.,,.,,,|||..,})},....)))))))))))).})))}.,)))))).........))))))))))))....(((((((((.(((....))).)))))))))))))))))......)))),....,,{((..(.(((((((((((...((((((((((((.((((.....(((({....)))))..)))).))))}..)))))))))))))))))).)..))).})))....))))))))),|,,,,,..{{{(((,..{{(((..(((((((.......(((((...))))))))))))..))))}.}})))),,),,,}},.))))))...)))...))))))....)).)).))).)))))))).)}|,,..,,}}}.....{{((.((((((...........)))))).))))}}}}}))))))}..,.....))))))))))))).,,,,{{{..|,(((((.{(({...)))).))))).}})))))}....)))..})).))))))))))))))...,,|||....,,|.(((((((.{(((((((((((.,,.((((....)))).,,|{,..{{{.......,|||.,}|}{(((({{{.{{,,....,))))))}}}})))))))...))))}..)))))))...{(((((((({{((((({{{{....||}}.......,((((((..(((.{{{........,,})))..)))))))))))).}))}....))))))}{{(((({.(({.{((((.........{((((....{{{....)))...)))))........))))).))).)))))))))))))))}|,}{((((((..{(((((.{{....}).)))))).,.))))))},.......},..........},,..

Transcripts

ID Sequence Length GC content
AAUUCAUUUAUCUGCAGGAAUGAUUGCUGCUAUCAGUCUCGCGCUCACC… 5260 nt 0.4755
Summary

This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. Members of this family are important during development. Aberrant expression of this gene is seen in medulloblastoma, a childhood brain tumor. This gene is closely linked to the gene encoding zinc finger protein of the cerebellum 4, a related family member on chromosome 3. This gene encodes a transcription factor that can bind and transactivate the apolipoprotein E gene. [provided by RefSeq, Jul 2008]

Forensic Context

A study in pigs (Sus scrofa) demonstrated that the ZIC1 gene is associated with cold response in fat tissue, where its H3K27ac modification levels and gene expression were higher in the chronic cold exposure group compared to the control in Min pig fat [Yaping Guo et al. DOI:10.1016/j.jgg.2024.06.017].