| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAUUCAUUUAUCUGCAGGAAUGAUUGCUGCUAUCAGUCUCGCGCUCACC… | 5260 nt | 0.4755 |
This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. Members of this family are important during development. Aberrant expression of this gene is seen in medulloblastoma, a childhood brain tumor. This gene is closely linked to the gene encoding zinc finger protein of the cerebellum 4, a related family member on chromosome 3. This gene encodes a transcription factor that can bind and transactivate the apolipoprotein E gene. [provided by RefSeq, Jul 2008]
A study in pigs (Sus scrofa) demonstrated that the ZIC1 gene is associated with cold response in fat tissue, where its H3K27ac modification levels and gene expression were higher in the chronic cold exposure group compared to the control in Min pig fat [Yaping Guo et al. DOI:10.1016/j.jgg.2024.06.017].