| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUUACUCACCCCCUAACGCCGAGUUCCUUUUCACUGUCUGUGGACAUU… | 7615 nt | 0.5769 |
This gene encodes a member of the PIAS (protein inhibitor of activated STAT) family of proteins. The encoded protein regulates the activity of various transcription factors, including the androgen receptor, Smad3/4, and p53. The encoded protein may also play a role in sumoylation. A translocation between this locus on chromosome 10 and the protein tyrosine kinase ABL1 locus on chromosome 9 has been associated with acute lymphoblastic leukemia. [provided by RefSeq, Mar 2010]
A study in rats demonstrated that the ZMIZ1 (Zinc finger, MIZ-type containing 1) was identified as a potential regulator of methamphetamine reward and addiction through transcriptome profiling of whisker follicles, showing an up-down regulated expression pattern (1.72 at MASA, 0.68 at WD) and a betweenness centrality score of 0.0176 [Song et al. DOI:10.1038/s41598-018-29772-1].