Basic Information

Symbol
ZMIZ1
RNA class
mRNA
Alias
Zinc Finger MIZ-Type Containing 1 KIAA1224 Zimp10 RAI17 MIZ Zinc Finger MIZ Domain-Containing Protein 1 Retinoic Acid Induced 17 RP11-519K18.1 FLJ13541 HZIMP10 Zinc Finger-Containing, Miz1, PIAS-Like Protein On Chromosome 10 Retinoic Acid-Induced Protein 17 PIAS-Like Protein Zimp10 TRAFIP10 NEDDFSA ZIMP10
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_020338.4
Sequence length
7615.0 nt
GC content
0.5769

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2866.70 kcal/mol
Thermodynamic ensemble
Free energy: -3003.67 kcal/mol
Frequency: 0.0000
Diversity: 2132.25
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...........((((((.(((..........((.((((..(((((..........(.(((((((.(.(((((..(((((((((.(((((..((((((.(((((((((((........((((.(((((((.(((.........))))))).).)).)))).......))))..(((((.(.(((((.(.(((.((.((((((.....)))))).))...))).)))))).))))))....)))))))...))))))(((((((((((.....))((((((((.((....((((((...))))))((((..(((((...))))).))))........)).)))))))))))))))))(((((((((((.(.(((((((..((((........))))...))).))))).))).).))))))).((((((((((...((((((....).)))))(((((..((((((((.(.....(((((..((((.((((((.((((.((((.((.........))))))))))..))))))(((((((((..(...(((((((.(((((((((((......((((((((((.(((((((..(((.(((...(((((.(((((.((((((...))))...))...)))))))))).......((((........))))((((.(........).))))(((((........))))).......))).)))...........(((((((..((.(((((((((..(((.((........)).))).)))))))))))...(..((((((((..(((((((((((((........))))...)))))))))...))))))))..).((((((.((((.......(((((.((.((((((((((.....((((...(((.....)))))))..(((((.((.((.((.((((((((..((((.((((.....))))..)))))).)))))).)).)).)).)).))).......((((......))))))))))........(((((...))))).............(((((.((..((.((((((((((......))))).))))).))..)).))))))))))).)))))......(((((((..((((((...))))))...)))))))................)))))))))).((((.......((((....)))).....))))........)))))))...(((((((((.(((((((((((((......((((((((.((((......)))).((((((((((....((........))....))).)))))))...........(((((((((((.....((((.(((((.....(((((....)))))......))))).))))....((((((......))))))(((.(((.(((((((((((((((...((((((((..(((((......)))))..))))).(((((((...))))))).(((((.((....)).))))).(((...(((((((.........)))))))))).(((((((.(((.((((.(((((.............(((((((.(((((...)))))(((........))).................((((((((((((((((((.(((((((((((.........((((.((((.(((((((((((((...(.((((((((..(.((((((.......((((........)))).)))))).)(((....)))....((((......(((.((.(..(((....)))..))).)))(((((...))))).................((((.......(((((((..((((.....(((....)))...))))...))))).)).........))))........))))(((.........))).......)))))))).).....((((..((.........))...))))))).)))))).)))).))))))))........)))))))).........))))))))........)))(((((.(((.............)))..))))).((((((..(((((((.((((...(((..((((..(((....))).)))).))).)))).))))))).................(((((((((((....................)))).)))))))..............((((..........))))..........))))))((.((....)).)).......(((.((((((.((((((..(((.((...(((((((..((((....)))).)))....))))..)).))).)))))).)))))).))).....(((((((((.....((.....)).....))))))))))))))))))).)))))))......(((..((.((((((((....((..(((((.(((((((((....)))...((((.(.(((((.((.....)).)).))).)))))((((.(((...(((((.....))))).))))))).)))))))))))..))...))))))))))..)))..((((((.((..((((((((.(((((.((((.((.........((((.((((.....((((..(((((.((((((((((((((((((((.(((((....)))))..(((((..((((((((..(((.(((..(((.....)).)..)))))).))))))))..(((...)))........)))))......)))))(((..(((((....))))).)))........))))))))).))))).).)))))..)))).....))))..))))..(((((............))))).....)).))))))).).).)))))..)))...)).))))))..))))).))))..)))...))))))))))...))))...))))))........)))))))).))).........))))))))))))))))))).))))).......((((((((..(((.((...(((.((.(((.......))).))...)))...))..)))))))))))..(((((.((..((((((.((((.((((..(((.......)))..))))..)))))))))).)).)).)))((((...(((.....)))..))))......)))))))).))))))))))).))))))))...(((((....(((((((.........((((((.((((((....))))))......................((((.(((.............))).)))).........(((((....)))))....)))))).....((((((....)))))).)))))))..))))).............(((.((((........)))).))).....(((......))))))))))((.....))........))))))))))))))).......))).)..)))))))))..)))).))))).......))))))))).))))).....((((((.(((((.......)))))))).)))))))))))))...))).)))))))))))..))))).)..)))))))).........))))))))).))((((((((((..................))))))))))..(((((.((((((.(((((((((....(((((..((((.((((...................)))).).))))))))))))......(((...(((((((((((...))).............((((.((((((.....))).)))...)))).......))))))))...)))................((.(((((((..(((((((((((((....(((((..((((((((..........((((((.(((.((((...)))).))).)))))).((((((((....(((..((((((......)))))))))))))))))))).))).)).))))))))).)))))((((.(((((............))))).))))...(((.((((....)))))))(((((..((.(((((.(((((((((((((.(((.....))).....(((((((((.((.(.((((....))))).)).)))))))))..(((((((....((.((((((((((((((((((.(((((..((...((((.......((((.((........))...)).)).......))))))..)))))((((....))))....((((((......)))))).))))))))).))).)))))).)).((((((..(((.(......))))...)))))).......................))))))).........)))))))))((.(((((((((......))))))))).))...........................((((((..(((((...............))))).)))))))))))))))..))..))))).))))....))))))).))..((((((((....))))).))).)))))))))))..)))))........((((.....))))...)))))))))(((((((.(((((((.((...............(((((((....((((.((((((.(((((((.....(((((.........)))))...(((((((((...((((.(((((.(..((((...(((((((.........)))))))....).)))..).))))).))))))).)))))).((((((((...((..((((((.((((......((((((..(((((....((.(((((((.(((.................(((((...)))))(((((.(((((((.(((...((((......)))).))).)))))))...).)))).))).))))))).))))))).))))))..)))).)))))))))))))))).(((((((((....((((.(((.((.((((....)))))).))).))))(((((..((.(((((......))))).))....))))))))))))))(((((.((.((((((.....)))))).)))))))..((((...)))).....))))))).)))))).)))).)))))))........)).)))))))......((....)).(((...)))............(((((((......(((....)))(((((((((....)))))))))......(((((......(((((((((((((..(((((....(((.(((....)))...((((((((((.((...((((......))))..))...((((.....((((.((((((((((.(((((..(((((((........)))(((((((((((((((((((((...(((......((((((((((.....(((((((((((....(((((((((...........)))...))))))..(((((..((((((((...((((((...((...(((.............(((((((......(((((.(((.((((.((((..((....((((...........))))....))..)))))))).))).)))))(((((((((.....(((((....))))))))))).))).........(((((((..(((....)))(((((((...))))))).((((((.............)))))).((((((((............)))))))).)))))))......(((.((((((((((((((....((((((..((((((.((((...........))))))))))..)))))).....)))))))...))))))))))))))))))))...))..))))))..((((((((..(((((.((.(((...))))))))))))))))))...(((...)))....((((((........))))))....)))))))).)))))....((((((....)))))).((((((.(((((.((((......((((((((...(((((((((....))))))))).((((((...(((....)))))))))...(((((((((.....)))))))))...(((((((..........((((((((..((((.((((.....(((((((((.(((..(((..(.((((((.(((((.......))))).)))))).)..)))...))).)))))))))((((((((((((((((((((..(((......))).....(((...(((.(((((((........))))))).))).)))))))))).))).))....))))))))))))))))..)))))))))))))))...))))))))......)).)))))))..)))))).......((((((((((((.....(((((((.((((.......)))).))))))).........))).))))......((((.........)))).)))))...)))))))))))((((...))))......)))))))))).......)))..))))).)))).)).))))).)))))))))..))))).))))))))))))))))))))).)))))))(((......)))..(((((((........(((.(((((...(((((((..(((((.....)))))....))).))))......((....)).(((((((......))).).))).((((((((..(((...)))...)))))))).(((.(((((.((((((.((((..(((..(((((....(.(((((((.((((((((...((.(((((((.(((..(((((....))))).))))))))))))...))))))))((((((..(((((.....))))).)))))).............(((((((...((.(((....((((((......))))))....))).)).))))))).))))))).).....)))))..)))...))))...).))))).)))))..)))..........................)))))))).....)))))))((((((..((.....((((((((((((((((........))))))))...............(((.((((((....((((((..((((.......)))))))))))))))).))).....))))))))....))..)))))).......)))...)).)))..)))))))))))))....)))))...........((..((((((((...)))))))).))..................(((((.......((.....)).....)))))...))))))).(((.(((((((((((((.(((................(((..((((((((((.(((.((((((((((.....))))).))))).))).)))...))))))).)))))).))))))))))))))))((((....))))..)))))))((((...((((....)))).))))...(((((((((..........)))))))))........
Thermodynamic Ensemble Prediction
.....,,,..,{(({..{((((.((((((({(..,((((.,,,||}}....}}}}}.||||,,|}|}|{{|{,,((((((,((.((((({{((((((.((,{(((({((..((,{({,{{((((,,||{|({{.||{.||..||||(((,,.({{,((,,.,|},.|}.,,.||||||}{{(.{{....|))||.}||}.|}},..))))))})))}))))))))))).))))))),..)))))),}..))))))|({({((((((,{,..|{{(((((((,((,.{{(({({{,,,|||}}|{(,...{.|||{,|}}||}..,}}...,}}}.},.)))))))}))))))}))(((((((((((..{({(((,(,{(({{.|,,,.,.)}}|,,|}))|,}}}},))}.).))))))).|||||||((({{{({(((,,.{{|{||,||({{(({{((((((,({({.({((,((({{(((({(({,{({((,(,{,,,..,.....{{{{||||||,|}}{{|||||{(((((((((..({,.((.((((,((((((((((({,...{((((((({{(,(,,..|||,({,{(({{{,(({{{.(((({{(((((,.,,||}|.|,,,..,||}}|||}}}...}},.|||.||,,|,{|,|{{||||,|,...,.,,{,{{{.(((((........)))))..}}}....},}}},..,}}}}}..}}||{,,..((.(((((((((..(((.((........)).))).))))))))))).((((((((,{(({..,||{||||||||,,,.}}}}})),||.{|||||||}|...||||||||,,||||...|}|},....}.|||||||.|||||{||{{{{{{{||,{{||..,|||..,,,))})}}}||,{{{.||||||||..,.((((.(.{((((({(((((((.((((((((.(((((.(((...,.((((((.{{{.({{(.,.((((((.((((((((.,..,.........(((((...)))))....|........(((((.((.{((.((((((((((......)))))})}))).)),})).))))).........((((....))))......((((((...))))))..})))))))..........)))))).}...))))},|(((.......((((....)))).....)))}.,....,.)))))).......))).))))))))((((((((......((((((((.,{{{......}|||.((((((({((....((......,.))....)))})))))))...,.......(((((((((((..,..{(((.(((((,,...(((((....)))))...|||))))).)))}....((((((......))))))(((.(((.(((((.{(((((({,...,,{(((((..(((((......)))))..))))).((((((({{{||||||,.((((,{(({{{{||{|||,,.({{...(((,{,(,...||,..))))))),||.{((((((.,{{.{,,,.,,{((..........,,.{((((((.(((((...)))))(((........))).................((((((((((((({(({{.((,((((((((.{..{,...((((.((((.(((((((((((((,,.(,((((((((..{.((((((.......((((........)))).)))))).,(((....||}....(({{......(((.({.{..|||,...}}}..}}}.}}}(((((...)))))..,....,,........,........,.(((({{{..{(((.,,,{{,,....|||...|||}...}}))).)),....},,.)}},.,......}},.(({.........))}.......))))))))}...,,.((((.,({.........))...)))))))})})))).)))).))))))))...,....)))))))).}}......|||||}}}........}}}{((((.({,...{,,.......,,...))))}.(((({{..(((((((.((((...(((..((((..(((....))).)))).))).)))).)))))))......,,,........{((((((((((....................))))}}})}))).............}}|||.,,}}}....||.{{{{.......,,,,,,|..}}}}.,}..||,......|{|,((((((.((((((.,({,.((...(({({{(..((((....)))).}}}}...)))).,)).})).)))))).}))))).}},.....(((((((((...,,({.,...})..,,,))))))))))))))))))).))))))}...,..(((..((,((((((((....((..(((((.(((((((((....,,,,,}((((.(.(((((.((.....)).))},)).)))))((((.(((...(((((.....))))).))))))).)))))))))))..))...)))))))))),.))).||||||{,|{..{|,,||||,||||,.||||.{,.........,,{{.,,,,}},..||||}}|||||}||,||||,,|||||||}|||}||,||}...,,|||{{((..(,,((,,{,,({{(((.{((((((....,.,|,|..,,,})).}}||||||{{(({{..,.{{{{.{{..,,,)).,}}}.||||{{{{,,|||,(((((((((|...|..{{{.....)))},)((((((({|.,,|{({.||||.....)))},,))))...||))))))}.......||{||.....)).)))))))))))))}}}}.,}}}...,,.))))))})))))).}}})}})))...}})))))),,...,))),,.))))).}}.}}})))))))))).))).........))))))))))))))))))).))))).)))....((((((({..({.{{...(((.((,((,,{,...,))),),.,,)))...,,..)}))))))))))))).)))))))|((({({((((.((((..(((.......)))..))))..)))))))))}..,.......((((...})))..|,|.(((((.....(((((((..(((......)))..))))))).....)))))....(((((((.........((((((.((((((....))))))..................,{..((((.(((.............))).))))..,,..,..{((((....))))}....)))))).....((((((....)))))).))))))).....))))))},))))...,||,||,,.......})),)}),)}....(((......))),}|,,.,....||,|}......,})}},,,|||||||},..,}.}})))....,,,,,,,,,...,,,.)))))}}}.}}}}))))),))}))))),}}}}||||||,(((({.......})))))}},}},}}}}||||||{{{|||{||||},,,|||.,|}))).,.||||}}},,..{{{{{{.,,,,,,|||{|.((((((((((.....,,....,}...,.))))))))))..((((({((((((,{((((({,{.,,.(((((..((((.((((...................}))).).)))))))),))}......|||,..(((((((({((...}}}........,.,,.((((.((((((.....)))},))...))))..,....))))))))...,,,.......,,{({{,.{((.(((({((..((({{{,{{,,,,.,..{{(((|,(({(((((,{,{...,,,((((((.(((.((((...)))).))).)))))).{(((((((...,{{{..((((((......))))))))})))))))||||..}},)).))}}}||||,|||||((((.(((,({,,,.||,,.,.,}}}}.}}}}.,,|{,|||||,,..)))))})|||||,,|{.{{{{{.{(((((((((((|.{{{.....)))..,..(((((((((.((.{.((({....)))),.)).)))))))))..{{{{{{{.{..((.((((((((((((((((((...,,{,,...,}|,||.......(((({,,.(({{{.,||{{,.|{|.....}}},,).))}}},)))||,,,.}.))))....((((((......)))))).))))))))).))).)))))).)).{(((((..(((.(......,}}),}}))}}},,,.....,,,,..........,,}))))}|.........}))))))))||.(((((((((......))))))))).,}..........,...,,,,.{{{{{{{.(((.,....,,||}.....,{{{....})))))})))).)})))))))).,}}..))))}|))))....))))))}.||||((({((({....,||||{|||.||},|||)}}}.||}},,.,,}|,..||}}}}}.,}}}},,.|}}}}||||({,{((({(((((((,({...{{{{{{{,,.{,(,,,,{{,..,||||}|||{{{,({((({,.....||{{{.....,,..}||||{{,((({{{(((...{(({.(((((.(..((({...{((((({.........}))))))....)}}))..}.))))).})))))).))))))}}||{{{{{,..,,..,{{{{|.||||,.,,,}|||||{,,|||||,,..||,{{|||||,|||.,,,,|...,}......(((((...))))),{{{{.{{(((((.({{,||{{{{......}))).))).))))))).}.),))),,))}.))))))),)))))}}.|||||}..,|)),,})))},,)))))))}}||{{{{|||,,}}||||}|||}}..||||....,)))))}})}.||))||,|||.((.(((({......))))).)).}}}),))))))))))))|(((({((.((((((.....))))))})),)))),.||||,},)})).....,))}))).))))))}))),,))),,)).,.,,,,.,,,))))))),))),.{,}}}}))}}}....)))}}}))))))))},))}}))..|||,{((|,,,|,,(((((((((....)))))))))...{..(((((......,{{{{{(((({{(.,{{{,||,,,|||,|||,.,.)))...((((((((((.((..,{(((,....,)))).,},..,{(((.....{(((.((((((((((.((((({,(((({({........}}}(((((((((((((((((((((...(((......((((((((({.....(((((((((((..,,({,{,(((((...})}}}|{{{{,,.{((((.((((((......,.(((((((..(((........)))..))))))).,)))))).))))},,.(((((.{({.((((.((((.,((.{,.{({(,..........}))}..,,,)},)))))))).})).))))}{{((((((({.,,,,{{{{....)))})))))))}.}}...,{{{{{(((((,.{((((((((((((((((((...})))))).((((((.............))))))..,{{{{{{{{....,,}}}.}}}},,)))))..}))))))}..,,.((((((((((((((....((((((,,((((((.((((...........)))))))))),,)))))).....)))))))...)))))))||{(((|||,{,{{((({,(((.{(({.((((((({.,((((((((.(((...))))))))))))))))))|,.{((({,,{{.,..((((((........))))))..}.)}}))))..}|{{{,,..,}}||,...})))})),||||||.,,{,,,{{(({,{...{{{|||||...(((((((((....))))))))).{{((((.,,{{{....})))))))}.,.(((((((((.....))))))))).,.||{||||}}}.,{{{..((((((((..(((,,((({.,,..(((((((((.(((..(((..(.((((((.(((((......,,)))).)))))).)..)))...))).))))))))){{((((((((((((((((((..(((,....|}}}.....{{{...(((.(((((((,.....,}))))))).))).})})))))))}})).))}...))))))))))))))))..)))))))),)),)),...,)))))))}}}}..||,}|}|||},.}}}))},......{{|||}|}||,|,|,.,||||(((,((((.......)))}.))))))),,..{{{{{|....,.}})))}.((((.........)))),,})))...)))))))))))((((...))))......))))))))))...,...)))..))))).))))},).))))).)))))))))}}))))).))))))))))))))}}},))),,))))))(((......)))..{((((((.....,,,({{.||{{,...(((((((..((((,.....,}})),,..)))},)))...,,,{,....))}||{{(((......))),)|)}}.{{||||||..|||,,,))),,,)}))}}}},(((.(((((.((((((.((((..(((..(((((....(,((((({{.((((((((...,{.(((((((.(((..(((((....))))).)))))))))),}...)))))))}((((((..(((((.....))))).))))))............,(({{{{|}|.{(,(((,,..((((({....,,|}}}}}.},,))}.)).}))))}),)))))}),),,,,.)))))..)))...))))...).))))).)))))..}))}}....,,...,,.............})}})}}}..,..}||||||{{({{{..,({{.{,{{((((,{,,,,,,||}},,}}..,))),,,...........,,|||{{{,{|{{,.{(((((((((..((((.......))))))))))))))||.|||,{...},,,,))),,,,,,..|},,,,.......,,|......,,)}}))}))))))))},....)})))...........{{..((((((((...)))))))).}}.....,.,,,........,,{(({.,....,,,,.,,})}||,.,}}||,,,||||,,,.{{,.{((((((((((((.(({.........,{{,{{{({{.,|||||||(((.(((.((((((((((.....))))).))))).))).)))...}}}}})}.)))))).)))))))))))))})),|||,...}}}},,|,},}},}}},,},||}|}|..,,,,..})},,.(((((((((.,,....,}.)))))))))....,...

Transcripts

ID Sequence Length GC content
ACUUACUCACCCCCUAACGCCGAGUUCCUUUUCACUGUCUGUGGACAUU… 7615 nt 0.5769
Summary

This gene encodes a member of the PIAS (protein inhibitor of activated STAT) family of proteins. The encoded protein regulates the activity of various transcription factors, including the androgen receptor, Smad3/4, and p53. The encoded protein may also play a role in sumoylation. A translocation between this locus on chromosome 10 and the protein tyrosine kinase ABL1 locus on chromosome 9 has been associated with acute lymphoblastic leukemia. [provided by RefSeq, Mar 2010]

Forensic Context

A study in rats demonstrated that the ZMIZ1 (Zinc finger, MIZ-type containing 1) was identified as a potential regulator of methamphetamine reward and addiction through transcriptome profiling of whisker follicles, showing an up-down regulated expression pattern (1.72 at MASA, 0.68 at WD) and a betweenness centrality score of 0.0176 [Song et al. DOI:10.1038/s41598-018-29772-1].