| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCUUUGGCCCCUCCCGCCGGGUGAGGUUGGCACCCCGUUUUUCCUGC… | 6588 nt | 0.4369 |
Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II transcription regulatory region sequence-specific DNA binding activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Predicted to be active in nucleus. [provided by Alliance of Genome Resources, Jul 2025]
A study in humans identified the ZNF844 as a top differentially expressed gene in the nucleus accumbens in individuals with alcohol use disorder through meta-analysis of postmortem brain RNA-seq data [Willis et al. DOI:10.1038/S41380-024-02777-1].